martes, 2 de octubre de 2012

ANÁLISIS DE LAS REGIONES GENÓMICAS 5’ NCR, 3’ NCR, Erns, E2 y NS3 Y SU PROBABLE INFLUENCIA EN LA EFICIENCIA REPLICATIVA DE UN AISLADO NACIONAL (CH511) DE VIRUS DIARREA VIRAL BOVINA René Ortega Vásquez 2012

PROGRAMA DE DOCTORADO EN CIENCIAS SILVOAGROPECUARIAS Y VETERINARIAS “ANÁLISIS DE LAS REGIONES GENÓMICAS 5’ NCR, 3’ NCR, Erns, E2 y NS3 Y SU PROBABLE INFLUENCIA EN LA EFICIENCIA REPLICATIVA DE UN AISLADO NACIONAL (CH511) DE VIRUS DIARREA VIRAL BOVINA” RENE EDGARDO ORTEGA VASQUEZ Tesis para optar al Grado Académico de Doctor en Ciencias Silvoagropecuarias y Veterinarias PROFESOR GUÍA: JOSE PIZARRO LUCERO SANTIAGO, CHILE 2012 PROGRAMA DE DOCTORADO EN CIENCIAS SILVOAGROPECUARIAS Y VETERINARIAS “ ANÁLISIS DE LAS REGIONES GENÓMICAS 5’ NCR, 3’ NCR, Erns, E2 y NS3 Y SU PROBABLE INFLUENCIA EN LA EFICIENCIA REPLICATIVA DE UN AISLADO NACIONAL (CH511) DE VIRUS DIARREA VIRAL BOVINA” RENÉ EDGARDO ORTEGA VÁSQUEZ Tesis para optar al Grado Académico de Doctor en Ciencias Silvoagropecuarias y Veterinarias COMITÉ DE TESIS Calificación Firma Dr. José Pizarro L. (Profesor Guía) Dr. Pedro Abalos P. (Profesor Consejero) Dr. Eugenio Spencer O. (Profesor Consejero) Dr. Romilio Espejo T.(Profesor Consejero) Dr. Fernando Santibañez Q. (Presidente Comisión) Financiamiento Proyecto FONDECYT Nº 1060581 SANTIAGO, CHILE 2012 RESUMEN El Virus Diarrea Viral Bovina (VDVB) se encuentra diseminado en todo el mundo, con prevalencias serológicas que fluctúan entre un 50% y un 90% en el ganado bovino, constituyendo en una de las principales causas de pérdidas económicas en la industria del bovino, estimadas entre USD 10-57 millones / millón de terneros. En Chile, el virus se ha aislado desde bovinos que presentan una gran variedad de cuadros clínicos, detectándose aislados de los dos genotipos descritos del VDVB (VDVB1 y VDVB2) y de cuatro subtipos del VDVB1 (1a, 1b, 1i y 1j) y uno del VDVB2 (2a). El propósito de esta tesis es determinar las bases genéticas de la virulencia de las cepas chilenas del VDVB. Con este objetivo, en una primera etapa se determinó la eficiencia replicativa del aislado nacional CH511 (genotipo 1j) con respecto a virus nacionales de los otros subtipos presentes en el país y posteriormente, se estudió el posible rol de las regiones 5’ NCR, 3’ NCR, Erns, E2 y NS3 del genoma viral en la eficiencia replicativa de este virus . En el estudio de la eficiencia replicativa del virus CH511, se pudo establecer que los 2 virus analizados del subtipo 1j (CH511 y CH1087) presentaron una mayor eficiencia replicativa que los 2 virus analizados del subtipo 1b (CH113 y CH1025), en parámetros como duración del ciclo infectivo, rendimiento viral y pendientes en la curva de multiplicación de un paso. En cambio, los virus del subtipo 1b tuvieron significativamente mayores pendientes que 1j en la curva de múltiples pasos y una infección célula a célula más eficiente. Posteriormente, las regiones 5’NCR, 3’NCR, Erns, E2 y NS3 del genoma de la cepa CH511 se secuenciaron y las secuencias nucleotídicas y aminoacídicas obtenidas se compararon con las secuencias equivalentes de la cepa estándar NADL del VDVB y con los virus chilenos pertenecientes a los otros subtipos del VDVB, con el objetivo de identificar zonas genómicas sospechosas de ser las responsables de las características replicativas de la cepa CH511. En este estudio, si bien se pudo encontrar diferencias nucleotídicas en las zonas 5’ NCR y 3’ NCR, la estructura secundaria de estas regiones, que sería determinante para su función, no se vería mayormente alterada. La región NS3 fue la más conservada y la región E2 fue la región más variable de las zonas analizadas. La región codificante para la glicoproteína E2, que corresponde al receptor viral, es una de las proteínas más importantes del virus y por lo tanto es probable que algunas de las diferencias aminoacídicas encontradas entre virus de distintos subtipos, puedan ser las responsables de las diferencias detectadas en la eficiencia replicativa y en la diseminación célula a célula. Por último, esta tesis también pudo establecer que la glicoproteína Erns presentó una mutación aminoacídica en el sitio activo de la actividad RNasa de la proteína (Y349H) en ambos virus pertenecientes al subtipo 1j, lo que prácticamente eliminó su actividad enzimática, lo que podría tener incidencia sobre la evasión de la respuesta inmune que induce esta proteína en el VDVB. Palabras Claves: pestivirus, virus diarrea viral bovina, virulencia, cepa CH511. ABSTRACT The Bovine Viral Diarrhea Virus (BVDV) is spread worldwide, with prevalence serological ranging from 50% to 90%. This virus is a major cause of economic losses in cattle, estimated between $ 10-57 million / million calves. In Chile viruses have been isolated from cattle that have a variety of clinical conditions, detecting isolated from both genotypes of BVDV (VDVB1 and VDVB2) VDVB1 four subgroups (1a, 1b, 1c and 1i) and a single subgroup of VDVB2 (2a). The purpose of this study is to contribute to elucidate the genetic basis of virulence of Chilean strains of BVDV. With this aim, we determined the role of the 5 'NCR, 3' NCR, Erns, E2 and NS3 viral genome replicative efficiency of the Chilean strain CH511 (GenBank No. AF356504). For this, the 5'NCR regions, 3'NCR, Erns, E2 and NS3 genome was sequenced strain CH511 and the nucleotide sequences obtained were compared with the nucleotide sequences of BVDV strain NADL standard and Chilean strains belonging to other subgroups and genotypes of BVDV. The aim is to identify and select genomic regions suspected to be responsible for the replicative characteristics of strain CH511. In biological characterization, we found that the strains had higher efficiency 1j 1b on parameters such as duration of the infective cycle, infectious virus titers, the yield of virions and the slopes in the curve of growth of a step. In contrast, 1b strains had significantly higher slopes in the curve 1j multiple steps and larger diameters of the bulbs in the test cell to cell spread. In the genetic characterization, although we found variation in zones 5 'NCR and 3' NCR, the secondary structure tends to be preserved. The NS3 region sequenced was the most conserved and E2 was the most variable region of the study areas, certainly in the latter may have areas that could affect replicative efficiency of CH511 and / or dissemination strategy, but you must follow investigate this region. Finally, Erns had a mutation in the active site RNase (Y349H) in 1j strains that decreased their activity, which could have an effect on evasion of the immune response induced by this protein in BVDV. Key Words: pestiviruses, bovine viral diarrhea virus, virulence, CH511F10 strain. INTRODUCCIÓN El Virus de la Diarrea Viral Bovina (VDVB) es el agente etiológico del complejo Diarrea Viral Bovina/ Enfermedad de las Mucosas (DVB/EM), descrito por primera vez en 1946, paralelamente en Estados Unidos de Norteamérica [1] y Canadá [2] asociado a epizootias de una enfermedad aguda ó subaguda, a menudo fatal, caracterizada por diarrea, depresión, anorexia y lesiones erosivas del tracto digestivo, principalmente en la mucosa bucal. Posteriormente en 1953, se describe un cuadro de curso crónico en que se presenta emaciación y debilitamiento progresivo; ulceraciones en lengua, paladar, esófago y hemorragia a nivel del tracto intestinal, denominándose este nuevo síndrome como Enfermedad de las Mucosas (EM) [3]. A fines de los ’60 se determina que ambas presentaciones son producidas por el mismo agente causal (VDVB), denominándose el síndrome como complejo DVB/EM y virus diarrea viral bovina (VDVB) al patógeno causal de las enfermedades [4]. La coinfección de una cepa citopática (CP) y una cepa no-citopática (NCP) del VDVB, con lesiones histológicas y anatomopatológicas severas son responsables de provocar la EM y la infección sólo con la cepa NCP, con cuadros clínicos suaves, o incluso subclínicos, son los que provocan la DVB [5]. Sin embargo, a fines de los ’80 surge un síndrome hemorrágico severo causado por una cepa NCP de VDVB (sin coinfección con cepa CP) reportado en diversos países [6-8]. En 1973, el término pestivirus, se acuñó para este grupo antigénicamente relacionado de virus [9] y fueron clasificados como un Género dentro de la Familia Togaviridae [10]. En aquel tiempo flavivirus también se clasifican como un Género dentro de la Familia Togaviridae. Los avances en la caracterización molecular de los flavivirus, sin embargo, reveló diferencias fundamentales en la estructura molecular, la estrategia de replicación y la organización genética entre los flavivirus y los otros miembros de la Familia Togaviridae. Estos hallazgos llevaron a la reclasificación de los flavivirus, en una nueva Familia viral, Flaviviridae, que inicialmente contenía sólo un Género, Flavivirus [11]. La publicación de la secuencia genómica de la cepa de VDVB, NADL, el primer pestivirus en ser secuenciado, reveló que los pestivirus tenían una mayor similitud en la organización genómica, expresión génica y estrategia de replicación con la Familia Flaviviridae que con la Familia Togaviridae [12]. Esto dio lugar a la reclasificación de pestivirus, en 1991, como un nuevo Género dentro de la Familia Flaviviridae [13]. Posteriores análisis filogenéticos de aislados identificados como VDVB, basado en el hospedero de origen y su presentación clínica, reveló dos grupos genéticos distintos, VDVB1 y VDVB2 [14, 15], que más tarde fueron clasificados como dos diferentes especies dentro del Género Pestivirus [16]. Adicionalmente, a las cuatro especies de pestivirus reconocidas, VDVB1, VDVB2, virus de la Enfermedad de la Frontera (vEF), y virus de la Peste Porcina Clásica (VPPC), otras especies han sido propuestas [17-21]. En el 2004, un novel pestivirus fue aislado de suero fetal bovino procedente de Brasil [22]. Posteriormente, otros aislados identificados en América del Sur y el Sudeste Asiático segregaban con este virus, según los análisis filogenéticos [23, 24]. Algunos de los aislamientos fueron desde suero fetal bovino, uno fue de un búfalo, y de manera significante, algunos fueron aislados, al parecer, de ganado persistentemente infectados (PI). La similitud en la presentación clínica con VDVB1 y VDVB2 y la capacidad de establecer PI en el ganado ha llevado a algunos investigadores a sugerir que este grupo de virus debe ser denominado como VDVB3 [21]. En la actualidad, el VDVB se encuentra diseminado en todo el mundo con prevalencias serológicas entre un 50% y un 90% [25, 26], siendo reconocida como una de las principales causas de pérdidas económicas en el ganado bovino, lo que ha llevado a definirlo como el patógeno viral más insidioso y devastador en los bovinos de los Estados Unidos de América. El estatus global de VDVB esta en transición, aun cuando programas de control en Escandinavia han resultado en casi la erradicación de VDVB en aquellas regiones [27], hay un reconocido crecimiento de las enfermedades asociadas a VDVB en otras especies además de bovinos en América, Sudeste de Asia y África [28-33]. En el año 2007, la Oficina Internacional de Epizootias (OIE) adicionó la DVB a la lista de enfermedades de notificación obligatoria, aunque solo en ganado bovino, no como una enfermedad reportable de múltiples especies. Esto puede llevar a confusión, ya que VDVB también replica y causa enfermedad reproductiva en otras especies domésticas, tales como cerdos, cabras y ovejas; y en diversas especies silvestres [13]. Aunque se necesita más investigación, la variación regional en la prevalencia de los subtipos de VDVB (especies y subgenotipos) y la variación en la protección cruzada entre los subtipos, sugieren que la protección de las vacunas se puede mejorar en base a la utilización de las cepas prevalentes de VDVB en las vacunas elaboradas para cada región [13]. El efecto detrimental por la infección viral afecta la producción de leche, el rendimiento reproductivo, retarda el crecimiento, aumenta la incidencia de otras enfermedades y aumenta la mortalidad en terneros, etc. [25, 34, 35], estimándose las pérdidas producidas por el VDVB entre USD 10-57 millones/millón de terneros sólo en el ganado bovino [36]. REVISIÓN BIBLIOGRÁFICA 1.- Etiología 1.1 Clasificación El virus de la diarrea viral bovina (VDVB) pertenece a la Familia Flaviviridae y es el prototipo del Género Pestivirus, que comprende al VDVB-1, VDVB-2, el virus de la peste porcina clásica (VPPC) y el virus de la enfermedad de las fronteras (vEF) [37]. Además, se han descrito nuevas especies de pestivirus infectando a jirafas y otros rumiantes silvestres, las que tentativamente, en especial el aislado de jirafa, podrían ser incluidas como nuevas especies dentro del Género [20, 22, 38]. Dentro de la Familia Flaviviridae, pestivirus presentan una mayor similaridad, en estructura genómica y mecanismo de iniciación de traducción, con los hepacivirus que flavivirus [16]. Estos virus son nombrados de acuerdo a la especie que afectan o la enfermedad que causan, sin embargo, VDVB-1, VDVB-2 y vEF son capaces de cruzar la barrera interespecie para infectar un amplio rango de hospedadores dentro del Orden Artiodactyla; en contraste a lo que ocurre con VPPC que infecta naturalmente sólo a cerdos domésticos y salvajes [19, 39]. 1.2 Características estructurales y biológicas Los pestivirus son partículas envueltas, esféricas y miden 40 a 60 nm de diámetro, formadas por una hebra positiva de RNA cubierta por una cápside formada exclusivamente por la proteína de la cápside (C) y cubierta por una membrana fosfolipídica que contiene tres glicoproteínas virales: Erns (ribonucleasa secretada), E1 y E2 [40-42]. El genoma del virus esta constituido de un ssRNA, de polaridad positiva, sin poli(A) en 3’ ni cap en 5’, con una longitud de 12.0 a 12.5 kb [18, 43]. Un extenso ORF de aproximadamente 4000 codones o aminoácidos(aa), es flanqueado por una secuencia 5’ NCR (región no codificante) de 372 a 385 nucleótidos y una 3’ NCR de 185 a 273 nucleótidos, no hay ARNm subgenómicos asociadas a infecciones con virus de la Familia Flaviviridae [18, 44]. El 5’ NCR no contiene una estructura cap [44]. Aunque no hay poli (A) presente en el 3’ NCR el genoma de los pestivirus termina con un breve tracto de poli (C). Además, el genoma se compone de ARN de cadena sencilla aunque hay una considerable estructura secundaria inherente como lo demuestra su capacidad de unir celulosa CF-11 en la presencia de 15% etanol [45], solubilidad en 2 mol/L LiCl y la resistencia a la hidrólisis por bajas concentraciones de RNAsa A [46]. Se cree que las estructuras de “stem loop” de la región no traducida 5’ son parte integral de la formación de un sitio interno de entrada ribosomal (IRES) que tiene por función dirigir la fijación del ensamble del ribosoma al primer codón del ORF [13]. La expresión de los genes virales ocurre vía síntesis de una poliproteína procesada co- y post-traduccionalmente en proteínas virales individuales por proteasas celulares y virales [43, 47, 48]. El orden de los productos de clivaje en la poliproteína de la cepa de referencia NADL de VDVB es NH2-Npro(autoproteasa N terminal)-C-Erns-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B-COOH [49, 50]. Las proteínas estructurales están representadas por C, Erns, E1 y E2 siendo codificadas por el primer tercio del genoma hacia el extremo 5’ mientras las restantes son las proteínas no estructurales (NS) codificadas por los dos tercios restantes hacia el extremo 3’, con excepción de la proteína Npro, la cual es codificada por el primer tercio del genoma viral [51]. Diferente a otros Flaviviridae, la primera proteína codificada en el largo ORF es una proteína no estructural, Npro, una autoproteasa responsable del clivaje del sitio Npro/C [52]. Al menos 3 proteasas del huésped escinden la región estructural del genoma del pestivirus, C/Erns, E1/E2, E2/p7 y p7/NS2, con incompleto clivaje de E2/p7 llevando a la acumulación de E2/p7 [53, 54]. El mecanismo de procesamiento de NS2-3 ha sido recientemente descubierto por identificación y caracterización de la autoproteasa NS2 [55]. El clivaje de NS2-3 puede ser incompleto, pero es esencial para replicación de RNA viral y reciente evidencia sugiere que NS2-3 es requerido para la producción del virión [56]. La escisión de la poliproteína que genera NS4A, NS4B, NS5A y NS5B son catalizados por la serinproteasa NS3-4A del pestivirus [57, 58]. Npro, que esta codificada en el inicio del ORF (precediendo la región codificante para las proteínas estructurales). La Npro es una proteasa, que se escinde por si misma del polipéptido viral. Esta proteína también produce la supresión del sistema inmune innato del huésped. Estudios sugieren que Npro previene la producción de interferón tipo I mediante el bloqueo de la actividad del factor regulador de interferón 3 (IRF3) [59, 60]. El segundo producto génico único es la glicoproteína de envoltura Erns, que posee una actividad RNasa intrínseca. Esta proteína se encuentra en la partícula viral infecciosa y también es secretada en forma soluble. Se cree que la Erns secretada evita la inducción de interferón beta mediante la unión y degradación de RNA de doble hebra [61]. Dentro de las proteínas estructurales, diversos reportes muestran que E2 es el mayor inductor de anticuerpos neutralizantes, sugiriendo un importante rol en el ingreso a través de un receptor del virus a la célula [62, 63]; y además determinante del tropismo celular, al menos en pestivirus de rumiantes [64]. Para Erns se ha reportado tener actividad intrínseca RNAsa, pero su rol en la infección viral permanece ambigua [65, 66]. De las proteínas no estructurales, NS4A funciona como un cofactor de la proteasa NS3 para el clivaje NS4B y NS5A y entre NS5A y NS5B [57, 58]. Adicionalmente, NS3 contiene secuencias NTPasa y helicasa; siendo estas actividades enzimáticas demostradas in vitro [67, 68]. NS5B contiene motivos característicos de una RNA polimerasa-RNA dependiente [69-71]. La función de NS5A es poco conocida, aunque se sabe que es fosforilada por una serina o treonina kinasa celular como ocurre con hepacivirus y flavivirus [72]. VDVB comprende un grupo heterogéneo de virus que primariamente infectan rumiantes y que varían en antigenicidad, citopatología y virulencia [51]. Al poseer una hebra única de RNA y replicar su genoma con una RNA polimerasa viral, el virus presenta una alta tasa de mutación, que da lugar a una gran heterogeneidad entre las cepas virales, lo que ayuda a adaptarse y evadir el sistema inmune del huésped [73]. Además de VDVB, el Género Pestivirus incluye el vEF y el VPPC, aunque recientemente se han aislado cepas, propuestas como nuevas especies, desde rumiantes silvestres [39, 74-76]. Originalmente, los pestivirus se caracterizaron como VPPC, vEF y VDVB sobre la base de las especies que fueron aisladas, sistema que resultó inviable porque pestivirus, en especial VDVB, no son hospedero específico y no pueden ser diferenciados por signos clínicos clásicos [73]. La diferenciación antigénica es complicada porque los pestivirus presentan reactividad antigénica cruzada y además diversidad antigénica , lo que dificulta, por ejemplo, la generación de anticuerpos policlonales o monoclonales que diferencien VDVB de VEF y VPPC; y que sean capaces de reconocer a todas las cepas virales de VDVB, por lo que el sistema más eficiente para la diferenciación de los distintos pestivirus está basado en el análisis genómico de los virus [73]. 1.3.- Genotipos de Pestivirus La genotipificación de Pestivirus aislados de diferentes especies animales permite la clasificación entre y dentro de especies virales ayudando, de esta forma, a identificar grupos virales más prevalentes en una zona determinada y así dirigir estrategias de control de la infección con estos patógenos, como aplicación de vacunas contra un determinado genotipo. De igual forma, la identificación de subgrupos dentro de genotipos en diversas zonas geográficas permite, frente a un brote, determinar la procedencia del virus que está actuando. Por lo tanto, cumple un importante papel en la epidemiología de estos virus. Actualmente, la genotipificación apunta a relacionar algunas características fenotípicas como antigenicidad, virulencia y producción de progenie viral, con un determinado genotipo o sub-grupo, para, de esta forma, agregar una importancia clínica a la clasificación. Existen varios estudios de neutralización cruzada que permiten la diferenciación de genotipos y subgrupos de Pestivirus, en forma coincidente con la genotipificación obtenida con el análisis filogenético, relacionando claramente una variante antigénica con un genotipo [19, 38, 77]. La clasificación de los Pestivirus puede llevarse a cabo mediante la construcción de árboles filogenéticos con secuencias nucleotídicas o aminoacídicas de diferentes zonas del genoma viral. Este método permite visualizar a los aislados en grupos y subgrupos genéticos dentro de las especies que forman el género. Por otra parte, mediante el análisis comparativo de distancias evolutivas entre pares de secuencias se puede determinar el parentesco genético entre diferentes aislados, estableciendo porcentajes de similitud nucleotídica que determinan rangos entre los que un aislado se considera una especie, genotipo o subgrupo diferente. Las zonas más comúnmente utilizadas son 5’ NCR y los genes que codifican para las proteínas Npro y E2. Estos análisis permiten tanto la clasificación en las cuatro especies: VDVB-1, VDVB-2, VPPC, vEF y un aislado atípico de una jirafa como además, cada especie en subgrupos [19, 73, 76, 78-81]. Se describen porcentajes de divergencia de 29- 45,5% para diferentes especies; de 16,3- 25,4% para subgrupos dentro una especie y de 3,9- 13,4 para aislados dentro de un subgrupo. Esto cuando se considera el genoma completo de los aislados [18]. Cuando se evalúan segmentos parciales, en el caso de E2 se describen porcentajes de divergencia de 41,4- 67,8% entre especies, 17,4- 40,8% entre subgrupos y porcentajes menores que 18,8% entre aislados dentro de un mismo subgrupo [19]. Para Npro los porcentajes descritos van entre 36,2- 55,9% para diferentes especies dentro del mismo género; de 16,2- 28,8% de divergencia entre subgrupos de la misma especie y porcentajes menores a 14,2% para aislados de un mismo grupo [19]. Finalmente, para el caso de 5’NCR se describen porcentajes de divergencia entre 23,4- 7,4 para diferentes grupos y menores a 14,8% para aislados dentro de un mismo grupo [81]. Aunque estos valores se superponen en el análisis de pares de secuencias, el análisis filogenético determina la clara formación de grupos y subgrupos genéticos dentro de la especie [81]. A medida que crecen las bases de datos de secuencias de Pestivirus y se van incluyendo en los análisis filogenéticos, se van formando más grupos dentro de cada especie. De esta forma, durante los últimos años se han propuesto nuevos grupos genéticos formados por Pestivirus atípicos aislados de un antílope americano [20], rebecos [82, 83] y de una partida de suero fetal [22] que corresponderían a otras especies u otros genotipos dentro de ellas. 2.- Enfermedad 2.1- Cuadros clínicos Tanto para VDVB-I, como para VDVB-II, la mayoría de las infecciones que se producen en individuos adultos inmunocompetentes resultan en enfermedad clínica leve o subclínica y el aislado obtenido posee uno de los dos biotipos, siendo el biotipo NCP el más frecuente [73]. Sin embargo, algunas cepas NCP del Genotipo II producen un cuadro de DVB que cursa con trombocitopenia, leucopenia, fiebre sobre 41º C por 3 o más días y hemorragia en tracto digestivo y mucosas, por lo cual se le llamó en un principio síndrome hemorrágico [51, 84-86]. En terneros, la infección es frecuentemente asociada con síntomas respiratorios y gastrointestinales tales como tos y diarrea [87, 88]. Aunque, tales signos pueden ser el resultado de infecciones concurrentes o secundarias [89-91], ya que VDVB actúa como un agente inmunosupresivo, principalmente asociado con una disminución de la respuesta inmune celular [92-94]. En hembras preñadas no inmunes, el virus infecta al concepto, independiente del tiempo de gestación, con una probabilidad efectiva del 100% [95]. Sin embargo, el resultado específico de la infección transplacentaria depende de la edad gestacional, por lo tanto, un amplio rango de fallas reproductivas pueden observarse en predios infectados [96], que incluyen, falla en la concepción, nacimiento de terneros persistentemente infectados (PI), malformaciones, muerte fetal, momificación, retardo en el crecimiento intrauterino, muerte perinatal y nacimiento de terneros débiles [97-99]. La infección durante el primer trimestre de gestación, específicamente entre los 45 y los 120 días de gestación, antes de que el feto sea inmunocompetente, puede resultar en una infección persistente [100]. Los animales portadores inmunotolerantes (PI) son los transmisores claves de la infección, ya que diseminan el virus continuamente, en grandes cantidades y a través de todos los fluidos corporales [101, 102]. Otra consecuencia de la infección persistente es la EM, una condición 100% fatal en los animales que la presentan [52]. Se presenta cuando un animal, que se ha infectado en la etapa intrauterina entre los 40 y los 120 días de gestación con una cepa NCP del VDVB, y por lo tanto, nace con la condición de PI, se sobreinfecta en la etapa postnatal con una cepa del mismo tipo antigénico o sea homóloga, pero de biotipo diferente, es decir CP [103-105]. Cuando la sobreinfección de un animal PI ocurre con una cepa CP heteróloga, desarrolla una EM de carácter crónico, que al igual que el cuadro agudo termina con la muerte del individuo afectado [103]. La signología de la EM se caracteriza por fiebre, depresión, anorexia, emaciación, con lesiones erosivas y necrosis en lengua, faringe, laringe y esófago [103-105]. La caracterización genética de pares NCP-CP aislados de casos de EM ha apoyado la hipótesis de que la cepa CP se genera vía recombinación de RNA, aunque en unos pocos casos las cepas CP aisladas carecen de este reordenamiento genómico [48, 106]. La presencia de este reordenamiento correlaciona fuertemente con un incremento en la expresión de NS3, aumentando la replicación de RNA viral y la citopatogenicidad en cultivo celular [16]. 2.2 Virulencia del VDVB La virulencia de las cepas de VDVB puede variar desde aquellas que producen cuadros subclínicos hasta las que provocan cuadros clínicos con alta mortalidad de los animales infectados [15, 87] . Entre cepas NCP de distintas virulencias se han reportado diferencias en el tropismo celular [84]. De hecho, las cepas asociadas a cuadro de DVB con sindrome hemorrágico pueden lisar los trombocitos, característica que no poseen las cepas clásicas de VDVB [107]. Al infectar experimentalmente animales con cepas NCP de distintas virulencias de los genotipos I y II, se ha observado que los animales infectados con las cepas más virulentas presentaban una mayor viremia, lo que da cuenta de una replicación más eficiente en el individuo infectado [84, 108]. Otro estudio demostró que independiente de su virulencia, ambos genotipos infectan los mismos tejidos, pero los aislados de genotipo VDVB-2 se encuentran en mayor cantidad en sangre y en tejidos que los del genotipo VDVB-1[108]. En un estudio realizado sólo con cepas VDVB-2, las cepas presentaron el mismo tropismo celular, sin embargo la viremia fue mayor, más prolongada y con lesiones en el sistema linfático y digestivo más severas en las cepas más virulentas, sugiriendo diferencias en la capacidad de provocar daño a nivel tisular [109, 110]. En el caso del VPPC, se ha demostrado que las cepas de mayor virulencia presentan una mayor razón viriones libres / viriones asociados a células (intracelulares), indicando que la mayor virulencia de una cepa se debería a una mayor cantidad de progenie como virus libres [111]. Los genotipos y subgrupos virales también se han asociado a cuadros clínicos característicos, estableciéndose que los virus de genotipo VDVB-2 se asocian más a abortos que los del genotipo VDVB-1 [112]. Mientras, los subgrupos VDVB-1b y VDVB-1d producirían preferentemente cuadros respiratorios [91, 113]. Estas diferencias de virulencia entre las cepas llevan a pensar que existirían caracteres genómicos conservados en los distintos grupos virales, que se expresarían en la infección de las cepas, mostrando diferencias entre ellas en la replicación y/o tropismos tisulares. La región 5’ NCR, es la más conservada del genoma viral y se ha visto que es crucial tanto para la replicación como para la traducción de las proteínas virales, ya que mutaciones en esta zona disminuyen la infectividad, expresada en una menor síntesis de genoma viral, progenie viral y formación de placas de infección más pequeñas [114, 115]. Esta atenuación también se expresa in vivo con una menor viremia y un cuadro clínico más leve en los animales infectados [116]. Además, estudios realizados con cepas virales de campo de distinta virulencia han mostrado que ésta se asocia a diferencias en la eficiencia traduccional de la región 5’ NCR [117]. Basado en el control de la replicación y la traducción es útil considerar dos subgrupos en los Flaviviridae: El primer grupo está formado por el Género Flavivirus y es caracterizado por una estructura cap tipo I en la 5' NCR y 3' NCR altamente estructurado. En este grupo hay evidencia de que los extremos 5 'y 3' se ubican juntos para causar la circularización del genoma (a veces referido como estructura “panhandle"), que podría ser una característica importante para el ARN-replicación [118, 119]. El segundo grupo formado por virus de hepatitis C, pestivirus, y virus de la hepatitis G, se controla la traducción por medio del sitio interno de entrada al ribosoma (IRES) en la región 5' NCR y tiene un corto y menos estructurado 3' NCR. Pestivirus y Hepacivirus tienen regiones IRES muy similares [120], el IRES de virus de la hepatitis G es 50% más largo y estructuralmente muy diferentes [121]. Con respecto a la región 3’ NCR, también se ha observado que es importante para una eficiente replicación y traducción viral, específicamente a nivel de la replicación del RNA y de la terminación de la traducción de las proteínas virales [122]. En otros flavivirus se ha demostrado que mutaciones en esta zona genómica producen una atenuación de la virulencia asociada a una disminución de la eficiencia de la infección viral en cultivos celulares [123]. La estructura secundaria de 3’ NCR comprende 4 dominios, cada uno formado por un “stem loop” individual, siendo el dominio 1 (ubicado hacia el estremo 3’ de 3’ NCR) el más conservado y la secuencia ACAGCACUUUA que se sitúa entre el dominio I y II común a VDVB y VPPC [124, 125]. Erns es una glicoproteína con actividad ribonucleasa, indispensable para el ciclo infectivo viral, ya que inhibe la activación de interferón β por RNA de doble hebra, mecanismo clave de la respuesta inmune innata antiviral [61]. La proteína Erns representa un componente esencial de la partícula de pestivirus. La deleción de la región que codifica Erns del genoma viral resultó en replicones autónomos capaces de replicar su ARN, pero no pudieron producir partículas virales infecciosas del virus [126, 127]. Además de su función como proteína estructural, Erns tiene la característica de poseer actividad intrínseca de RNasa [65, 127-129], cuyo sitio activo exhibe secuencias homologas con RNasa Rh, miembro de la Superfamilia RNasa T2/S [129, 130]. Erns carece de una región transmembrana típica y se asociaría con la cubierta del virus a través de su región C-terminal, que constituye muy probablemente una hélice anfipática [131, 132]. La proteína no sólo es parte de la envoltura viral sino también se secreta en cantidades considerables en el espacio extracelular [41, 131, 132]. E2 es la glicoproteína mayoritaria en la partícula viral, posee los epítopes críticos en la estimulación inmunogénica de anticuerpos neutralizantes [133], siendo además el principal receptor viral para pestivirus [134]. Se ha visto que es un importante determinante de virulencia en VPPC, ya que en un estudio se demostró que la E2 de una cepa atenuada fue la responsable de una menor síntesis de progenie viral y de la formación de placas de infección más pequeñas en cultivos celulares en relación a una cepa más virulenta, encontrándose que la cepa menos virulenta presentó in vivo, una menor diseminación de la infección, menor replicación viral a nivel tisular, menor viremia y un cuadro clínico más leve y de menor duración en los cerdos infectados que la observada con la E2 de la cepa más virulenta [135]. La porción menos conservada del genoma del VDVB codifica para la proteína E2 que tiene los epítopes que son reconocidos por el sistema inmune, por lo que el cambio en estos epítopes permite la evasión de la neutralización viral [73]. Garry y Dash (2003) definen la glicoproteína de envoltura E2 de pestivirus como proteínas de fusión clase II truncadas. Según ellos, E1 y E2 de pestivirus tienen dominios C-terminal hidrofóbicos que podrían funcionar como anclajes de transmembrana, por lo tanto, postulan que, o bien E1 ó E2 de pestivirus debe ser la proteína de fusión de pestivirus, aunque describen en E2 un péptido fusión entre los aa 818-828 que contiene una secuencia consenso con aa aromáticos e hidrofóbicos situados entre dos residuos de cisteína [134]. Por otra parte, Hulst y Moormann (1997) han demostrado que Erns también puede participar en el proceso de adsorción y penetración virus-célula, ya que Erns y E2 interactúan con diferentes receptores de superficie celular y además la inhibición de la infección por VDVB de células porcinas y bovinas por E2 de VPPC sugirió que E2 de VPPC y VDVB comparten un receptor idéntico [136]. El receptor celular para E2 corresponde a CD46 [137]. En los virus NCP la proteína NS2-3 siempre se encuentra como una molécula única, en cambio, en los virus CP, NS2-3 se procesa parcialmente generando NS2 y NS3, encontrándose en el citoplasma celular NS2-3, NS2 y NS3 [52]. Sin embargo, un estudio reciente indica que en una fase temprana de la infección viral, la proteína NS2-3 tiene la capacidad de autoprocesarse generando las proteínas NS2 y NS3, tanto en los virus CP como NCP, pero a tiempos tardíos los virus NCP dejan de autoprocesar NS2-3, lo que no ocurre en virus CP, afectando la eficiencia de síntesis de RNA viral que depende del autoprocesamiento de NS2-3, indicando que la escisión de esta proteína es importante para el control de la replicación y la patogenicidad de VDVB [55]. NS3 presenta un dominio serina proteasa, tipo quimiotripsina, que se compone de aproximadamente 180 residuos y está presente en todos los miembros de los Flaviviridae [13]. Además de la función de serina proteasa, NS3 posee actividades helicasa y NTPasa [138, 139] que son esenciales para la replicación del ARN viral [67, 68]. Los virus agrupados bajo el título de BVDV son muy heterogéneos y abarcan virus que pertenecen a dos especies diferentes. Los virus de ambas especies pueden existir como dos biotipos diferentes, citopático y no citopático, y tienen diferente virulencia, desde avirulenta a altamente virulentas. Las dos especies reconocidas de VDVB son VDVB1 y VDVB2. Aunque esta segregación se basó primero en el análisis filogenético [14, 15], la posterior caracterización de cepas virales de las dos especies demostró diferencias antigénicas [51]. La significancia práctica de las diferencias antigénicas observadas se evidenció en el fracaso de las vacunas y las pruebas diagnósticas basadas en cepas VDVB1 para el control y detección de cepas VDVB2 [13]. Aunque los virus VDVB1 y VDVB2 tienen reacción cruzada, pueden ser diferenciados en base a sus diferencias antigénicas. Los títulos de anticuerpos neutralizantes encontrados en sueros de animales convalecientes son, generalmente, varias veces superiores contra los virus de la misma especie en comparación con los virus de la otra especie [140, 141] y los patrones de unión de anticuerpos monoclonales son distintos [14, 142]. A pesar de que las diferencias antigénicas pueden ser utilizadas para diferenciar las especies, la relación de la secuencia de nucleótidos es el criterio más fiable. Las diferencias entre los genomas de VDVB1 y VDVB2 no están circusncritas a una sola región y las diferencias pueden ser encontradas a lo largo de todo el genoma [43]. Las diferencias en algunas regiones del genoma entre VDVB1 y VDVB2, sin embargo, son más susceptibles de comparación o tienen un mayor significado biológico. La región 5’NCR, es la región más comúnmente utilizada para la detección y la caracterización, por que posee motivos altamente conservados que son favorables para su amplificación por RT-PCR. Debido a que la región Npro es única en pestivirus, la comparación de esta región está ganando adeptos para la caracterización de las especies de pestivirus putativos [13]. El análisis filogenético también ha revelado agrupaciones subgenotípicas dentro de las especies de VDVB1 y VDVB2, 12 en los virus VDVB1 (VDVB1a, VDVB1b, VDVB1c, VDVB1d, VDVB1e, VDVB1f, VDVB1g, VDVB1h, VDVB1i, VDVB1j, VDVB1k y VDVB1l) [81] y dos en los virus VDVB2 (VDVB2a y VDVB2b) [143]. Por otra parte, han sido identificados subgenotipos adicionales en aislamientos de VDVB1 desde ganado vacuno en el sur de África y Suiza, los cuales aún no han sido clasificados definitivamente [77, 144, 145]. Los estudios han mostrado diferencias antigénicas entre los subgenotipos como lo demuestran las diferencias observadas en pruebas de neutralización cruzada [33, 77], unión de anticuerpos monoclonales [142] y la respuesta de animales PI a vacunación heteróloga [140]. No se sabe, sin embargo, si las variaciones de los subgenotipos son suficientemente significativas como para tener un impacto en la detección o la protección proporcionada por la vacunación [13]. Las cepas de VDVB pueden existir como uno de los dos biotipos, citopático y no citopático. La segregación del biotipo se basa en la actividad del virus en los cultivos de células epiteliales. Los virus no citopáticos predominan en la naturaleza. Los virus citopáticos son poco frecuentes y generalmente se encuentran en asociación con brotes de la enfermedad de la mucosa, una forma poco común de infección con el VDVB y de alta mortalidad. Se cree que las cepas citopáticas surgen a partir de cepas no citopáticas, a través de eventos mutacionales que resultan en la escisión de la proteína viral NS2/3 en las proteínas NS2 y NS3 [13]. El evento mutacional más frecuentemente observado, que resulta en cambio de biotipo del VDVB, es la recombinación, en la cual pequeños trozos de código genético se insertan en el genoma de una cepa no citopática de VDVB [146]. El código insertado puede provenir de otro VDVB o de la célula hospedera infectada. No todos los eventos de recombinación están asociados al cambio de biotipo, ya que algunos virus no citopáticos tienen inserciones y algunos virus citopáticos no tienen inserciones [43, 141]. La citopatología in vitro no se correlaciona con la virulencia in vivo. La forma clínica más grave de la infección aguda de VDVB se asocia con virus no citopático [15, 85, 107, 141]. La importancia del biotipo de VDVB para los programas de control, yace en que VDVB no citopático, pero no VDVB citopático, puede establecer un PI en un feto que puede perdurar toda su vida. Por esta razón, la mayoría de las vacunas vivas modificadas usan como virus vaccinal, VDVB citopático [13]. Cepas de alta y baja virulencia de VDVB2 han sido caracterizadas [51, 109, 110]. En los Estados Unidos, las cepas de baja virulencia de VDVB2 se han seleccionado para su uso en vacunas vivas modificadas [140]. Aunque hay variaciones en la virulencia de cepas de VDVB1, hay poca información disponible en la literatura. Hasta la fecha, las cepas más virulentas de VDVB caracterizadas pertenecen a la especie VDVB2 [13]. 2.3 Multiplicación del virus diarrea viral bovina El proceso de multiplicación del VDVB se inicia con el reconocimiento de moléculas que están incluidas o íntimamente asociadas con la membrana citoplasmática de la célula hospedera. Se describe a una lipoproteína de baja densidad, que se repite múltiples veces en la superficie celular, como único receptor para la glicoproteína E2 del VDVB y que también facilita la endocitosis de la partícula viral. Por parte del virus, las gliproteínas de la envoltura Erns y E2, pueden unirse independientemente a diferentes moléculas de la superficie celular. Al parecer, Erns se uniría a glicosaminoglicanos de la superficie celular y sería el evento inicial en la adsorción [13], pero, la habilidad del VDVB de infectar un rango relativamente diverso de tipos celulares, así como también el tropismo por los tejidos y especies hospederas están condicionados a la glicoproteína E2 [147]. La internalización de la partícula viral se produce por endocitosis y el RNA genómico es liberado en el citoplasma, posterior a la acidificación de la vesícula endosomal [147]. El RNA genómico actúa directamente como RNA mensajero para la traducción de proteínas virales y como plantilla para generar genomas de progenie. Al parecer, la replicación ocurre en el lado citoplasmático del retículo endoplásmico y se requiere de factores celulares para completar los procesos[148]. El inicio de la traducción del genoma es de tipo Cap-independiente y es mediado por una secuencia nucleotídica conocida como IRES (del inglés, Internal Ribosome Entry Site), que se ubica en el extremo 5’ UTR del genoma y permite comenzar la traducción del RNA mensajero uniéndose a la subunidad ribosomal 40S, dando lugar a la producción de proteínas no estructurales y estructurales [147]. Las proteínas virales no estructurales se ensamblan en un complejo funcional de replicación y sirven, en parte, para catalizar la transcripción de RNA de sentido positivo a una hebra RNA complementaria de sentido negativo. El RNA de sentido negativo provee plantillas para sintetizar nuevas moléculas de RNA sentido positivo, usando un modelo de replicación asimétrico semiconservativo. El modelo incluye tres RNA virales, una forma replicativa de dos hebras, una hebra parcialmente simple y parcialmente doble y un RNA viral de una hebra. El cambio de la función del RNA, de un ciclo de traducción a replicación, se debe a la participación de estructuras y funciones de 5’UTR, incluyendo sitios del IRES; a la acumulación de proteínas virales, como NS5A y NS5B que pueden inhibir la traducción dependiente de IRES; a la participación de proteínas regulatorias que interactúan con el genoma viral fuera de las IRES; a la interacción entre los complejos proteicos de traducción del virus y de la célula y a la competencia por la replicasa y el ribosoma [13, 115]. Las proteínas virales son procesadas por proteasas virales y celulares para generar proteínas virales maduras. Las proteínas de la cápside son liberadas de la membrana del retículo endoplásmico e interactúan con RNA genómico seguido por el reconocimiento de dominios citoplasmáticos de proteínas de la envoltura. Los viriones VDVB parecen madurar en vesículas intracelulares en el aparato de Golgi o en el retículo endoplásmico, donde la envoltura lipídica es adquirida a través de la salida en el lumen vesical. La maduración del virus, incluyendo la estabilización de la conformación a través del doblado de la glicoproteína de E1-E2 y el transporte asociado a las superficie celular, es mediado por las enzimas y procesos de las células del hospedero [149]. Los viriones intactos son liberados por gemación hacia la cisterna del retículo endoplásmico [150], seguido por exocitosis con la detección de virus extracelular tan temprana como 8 horas post infección [13]. En modelos de cultivo celular, la replicación de VDVB ha sido detectada dentro de 4-6 horas después de la infección, con títulos máximos a las 12-24 horas post infección [151]. 3.- Epidemiología 3.1 Situación Mundial La transmisión se realiza por contacto directo con animales clínicamente enfermos y, principalmente, los PI que eliminan el virus por secreciones y excreciones como nasales, saliva, leche, heces y orina [5, 152]. Además, se ha demostrado experimentalmente la transmisión indirecta a través de objetos, como agujas hipodérmicas o espéculos, contaminados primariamente por PI [153-155]. Si el virus se conserva en el vehículo, por ejemplo, en el semen de toros agudamente infectados o PI, embriones o productos inyectables contaminados, el potencial de propagación se incrementa [102, 156-159] Asumiendo que la presencia de anticuerpos séricos en animales no vacunados refleja exposición al virus, podemos decir que el VDVB es uno de los agentes infecciosos virales más comunes del ganado bovino y se encuentra distribuido mundialmente, con prevalencias serológicas, en general, mayores al 60 %; en países como Gran Bretaña, Australia, Nueva Zelanda, Canadá [95, 160], Japón [161], Holanda [162] y en diversas regiones de la ex-Unión Soviética [163] y de América del Sur [164]. Sin embargo, la prevalencia de predios con signos recientes muestran una amplia variación entre países y entre regiones dentro de países [165-170]. Dentro de los predios, sin vacunación, la prevalencia de anticuerpos séricos será usualmente alta, si existen PI en éste [25]. El riesgo de incidencia anual a nivel de predios, estimada en predios endémicos, es de 0.08 a 0.48 [25, 171], en cambio en áreas con control sistemático de la infección, reportes muestran una disminución del riesgo a aproximadamente 0.02 a 0.03 después de 5 años de implementación del programa [172, 173]. 3.2 Situación en Chile El VDVB fue aislado por primera vez desde un brote de EM en terneros de la zona sur del país [174], lo que confirmó las sospechas de los hallazgos anatomopatológicos que se observaron en la necropsia de éstos animales, por la presencia de lesiones entéricas típicas [175]. Posteriormente se ha detectado la existencia de seropositividad en diversos estudios realizados en el país. Según las prevalencias serológicas obtenidas en estas pesquisas, se considera que el VDVB está ampliamente difundido en Chile. Una prospección serológica realizada en la IX y X Región se obtuvo un 100% de los predios con al menos un animal seropositivo, siendo la prevalencia individual de 73,8% [176]. En la Región Metropolitana, las pesquisas serológicas han evidenciado un 60% del ganado lechero y un 86 % del ganado de carne positivo, con una prevalencia predial de 96% y 100% respectivamente [177, 178]. Los estudios han permitido la identificación de portadores inmunotolerantes en la Región Metropolitana, detectándose un 19% de bovinos PI, indicando que la detección de infección persistente es mucho mayor cuando el muestreo es dirigido a predios con problemas y que presentan manejos sanitarios deficientes [179]. En cuanto a la caracterización molecular de los aislados, se han identificado cepas del Genotipo 1 y 2 en Chile, aisladas tanto de animales asintomáticos, como de animales con variados cuadros clínicos [33, 180]. La genotipificación de los aislados del genotipo 1 estableció la existencia de cepas del subgrupo 1a, 1b y 1c [33]. De los aislados nacionales caracterizados se eligieron 4 (1 aislado genotipo 1b, 1 aislado genotipo 1c y 2 aislados genotipo 2) que se caracterizaron antigénicamente por seroneutralización cruzada encontrando bajos títulos (diferencia de títulos de 11 a 61 veces) o ninguna antigenicidad cruzada entre ellos, lo que sugiere primero que pertenecen a grupos antigénicos muy diferentes y cuando se evaluó la antigenicidad, con respecto a la cepa NADL (usada por la mayoría de los laboratorios internacionales como cepa vacunal) esta también fue baja, demostrando la baja inmunogenicidad que las vacunas comerciales confieren para algunas cepas circulantes en Chile [33]. La caracterización biológica de estos 4 aislados, en cuanto a su citopatogenicidad, tropismo celular y ciclo infectivo viral, estableció que los aislados no producían efecto citopático en cultivo celular (cepas NCP), presentaban la misma eficiencia de síntesis de progenie viral por ciclo infectivo y tenían el mismo tropismo celular. Sin embargo, los virus presentaban diferencias en la eficiencia y diseminación de la infección, duración del ciclo infectivo viral y número de ciclos infectivos a 30 horas post-infección de cultivos celulares [181], lo que podría sugerir diferencias importantes entre las distintas cepas virales a nivel de la eficiencia de la infección de animales y posiblemente a nivel de virulencia de las cepas. Los antecedentes entregados denotan la gran variedad genómica, antigénica y biológica del VDVB a nivel mundial. Además, Chile presenta una situación similar a la analizada en la literatura, lo que sugiere que existirían cepas virales nacionales de distinta virulencia, las que serían responsables de cuadros clínicos de distinta gravedad. El propósito de este estudio es aportar al conocimiento de las bases genéticas de la virulencia de las cepas chilenas del VDVB. Con este objeto, se buscará identificar las zonas del genoma viral, importantes en la eficiencia de la infección viral para la cepa chilena CH511 (Nº GenBank AF356504). Esta cepa nacional (genotipo VDVB-1c) que presentó, en el estudio señalado anteriormente [181], una mayor eficiencia replicativa con respecto a otros aislados autóctonos, expresada en un ciclo infectivo significativamente más corto que otras tres cepas nacionales (1 cepa genotipo VDVB-1b y 2 cepas genotipo VDVB-2a) y la cepa de referencia NADL. Por esta razón y tomando en cuenta lo observado por otros investigadores, en cuanto a que las cepas más virulentas presentaban una mayor viremia, lo que evidenciaba una replicación más eficiente en el individuo infectado [84, 108]; se intentará buscar marcadores genómicos en la cepa CH511 asociados a las diferencias en la replicación en cultivo celular como una característica de cepas más virulentas. Para ello, las regiones 5’NCR, 3’NCR, Erns, E2 y NS2-3 del genoma de la cepa CH511 se secuenciarán y las secuencias nucleotídicas obtenidas se compararán con las secuencias nucleotídicas de la cepa estándar NADL del VDVB y con cepas chilenas pertenecientes a otros subgrupos y genotipos del VDVB. El objetivo es identificar y seleccionar zonas genómicas sospechosas de ser responsables de las características replicativas de la cepa CH511. HIPÓTESIS La alta eficiencia replicativa de la cepa chilena CH511 (Nº GenBank AF356504) en relación a la cepa de laboratorio NADL está asociada a alguna(s) zona(s) específica(s) de las regiones 5’NCR, 3’NCR, Erns, E2 y NS3 del genoma del VDVB. OBJETIVO GENERAL Establecer las zona(s) genómica(s) de las regiones 5’NCR, 3’NCR, Erns, E2 y NS3 del genoma viral, como posibles responsable(s) de la alta eficiencia replicativa de la cepa chilena CH511 en relación a la cepa de laboratorio NADL y a virus de los otros subtipos del Virus Diarrea Viral Bovina autóctonos de nuestro país. OBJETIVOS ESPECÍFICOS 1.- Determinar la eficiencia replicativa del aislado nacional CH511 (genotipo 1j) con respecto a virus del mismo y otros subtipos presentes en el país. 2.- Identificar zonas genómicas de las regiones 5’ NCR, 3’ NCR, Erns, E2 y NS3 como posibles responsables de las características replicativas de la cepa CH511. MATERIALES Y MÉTODOS 1.- Determinar la eficiencia replicativa del aislado nacional CH511 (genotipo 1j) con respecto a virus de genotipo homólogo y otros subtipos presentes en el país. 1.1 Cepas: Para el cumplimiento de este objetivo se ocuparon nueve cepas chilenas, 2 cepas de cada subgrupo: VDVB1a, 1b, 1c, 1i y 2a (Tabla Nº 1). Tabla Nº 1. Antecedentes de aislados chilenos del VDVB seleccionados para la caracterización biológica y genética. Virus Año de aislamiento Origen Cuadro clínico Genotipo 916 2003 X – Valdivia PIT 1a 1091 2007 VIII – Chillán SANO 1a 113 1995 RM - María Pinto PIT 1b 1025 2007 RM – Melipilla PR 1b 921 2003 X - Los Muermos PIT 1i 1068 2007 RM – Melipilla PR 1i 511 1993 VI – Rancagua ABORTO 1j 1087 2007 VII – Cauquenes SANO 1j 809 1998 RM - María Pinto DIARREA 2a Los virus se seleccionaron desde aislados obtenidos desde muestras de sangre de predios ubicados tanto en la Zona Central (Región Metropolitana, VI, VII Región) como en la Zona Sur del país (VIII, IX, X Región), Regiones que concentran la mayor parte de los predios ganaderos de Chile. El pool de aislados, desde los cuales se seleccionó las cepas para el estudio, se pueden dividir en 3 grupos. De esta manera, se cumple el objetivo de estudiar un grupo de virus que tuvieran una amplia diversidad en cuanto a su origen, genética, cuadro clínico asociado y temporalidad. Los grupos se describen a continuación: Grupo 1: virus prevalentes (2006-2007), aislados en el Laboratorio de Virología de la Facultad de Ciencias Veterinarias de la Universidad de Chile desde bovinos infectados naturalmente en la zona central del país. La finalidad era disponer para el análisis de virus que se encontraran circulando en estos momentos en los bovinos nacionales. Para ello se tomaron 226 muestras de sangre de predios ubicados tanto en la zona central (Región Metropolitana, VI, VII Región) como en la zona sur del país (VIII, IX, X Región), que poseen la mayor parte de los predios ganaderos de Chile. Los predios muestreados presentaban animales con signos clínicos que los hacían sospechosos de estar infectados con el VDVB, como por ejemplo aborto, repetición de celo y diarrea. También fueron tomadas muestras de animales asintomáticos o sanos por ser posibles portadores inmunotolerantes del virus. A las muestras de sangre se les realizó la prueba de seroneutralización o la prueba de ELISA para determinar el título de anticuerpos seroneutralizantes contra el VDVB. A las muestras que presentaron bajos títulos de anticuerpos o negativas a ELISA se procedió a inocularlas en células MDBK. Las muestras de plasma y suero se inocularon sobre monocapas de células MDBK, libres de infección con el VDVB, por 72 horas a 37°C (pasaje). La presencia del VDVB en las células se detectó por inmunofluorescencia directa (ID). Los virus se multiplicaron en los cultivos celulares hasta tener una cantidad de virus suficiente como para infectar el 75% de las monocapas de células. El número de pasajes realizados para obtener los 27 virus aislados fue de entre 3 a 14 pasajes para cada virus. De este grupo se seleccionaron las cepas 1091 (subtipo 1a), 1025 (subtipo 1b), 1068 (subtipo 1i) y 1087 (subtipo 1j). Grupo 2: virus aislados previamente en la Zona Sur del país (2003 a 2005). Estos virus (8 cepas) fueron aislados en la IX y X Región del país, los que se mantenían congelados en el laboratorio del Dr. Ricardo Felmer de INIA-Carillanca de la IX Región y en el laboratorio del Dr. Germán Reinhardt del Instituto de Microbiología de la Facultad de Ciencias de la Universidad Austral de Chile. En el Laboratorio de Virología de la Facultad de Ciencias Veterinarias de la Universidad de Chile fueron reactivados, multiplicándolos en monocapas de células MDBK, libres de infección con el VDVB, hasta tener una cantidad de virus suficiente como para infectar el 75% de las monocapas de células. El número de pasajes realizados para obtener los 8 virus fue de entre 3 a 7 pasajes para cada virus. De este grupo se seleccionaron las cepas 916 (subtipo 1a) y 921 (subtipo 1i) Grupo 3: virus aislados previamente en el Laboratorio de Virología de la Facultad de Ciencias Veterinarias de la Universidad de Chile, desde la zona central del país (1993 a 1998). Estos virus (10 cepas) fueron aislados en la VI Región y Región Metropolitana. Los virus también fueron reactivados, multiplicándolos en monocapas de células MDBK, libres de infección con el VDVB, hasta tener una cantidad de virus suficiente como para infectar el 75% de las monocapas de células. El número de pasajes realizados para obtener los 10 virus fue de entre 3 a 11 pasajes para cada virus. De este grupo se analizaron las cepas 113 (subtipo1b), 511 (subtipo1j), y 809 (subtipo 2a) 1.2.- Cultivos celulares: Los aislados virales se multiplicaron en monocapas de células epiteliales Madin-Darby Bovine Kidney (MDBK) de bovino (NºATCC: CCL-22TM), libres de infección por el VDVB. Las células MDBK que se encontraban congeladas en Nitrógeno líquido a -196º C fueron sembradas en botellas de 10 mL en medio de cultivo esencial mínimo (MEM) (medio esencial mínimo, Nº catálogo 41500-034 GIBCO-INVITROGEN) con suero equino al 8%, adicionado de 200 UI de penicilina G sódica y 200μg de estreptomicina por cada mL de medio. Las células se incubaron por 72 horas a 37° C hasta obtener un 100% de monocapa. Transcurridas las 72 hrs. de incubación se eliminó el medio de cultivo, las células se lavaron una vez con 10 mL de solución salina A de Puck y una vez con 1 mL de tripsina-verseno (Tripsina 0,05% Verseno 0,02% en Salina A de Puck). Las células se desprendieron de la monocapa celular incubando 10 minutos a 37° C con 0,5 mL de tripsina-verseno, luego de lo cual se ajustó la concentración de las células a una cantidad de 100 mil células/mL, agregando medio de cultivo MEM con suero equino 5%. Para botellas de 10 mL se sembraron 10 mL de la suspensión celular y para tubos, 2 mL, luego de lo cual las células se incubaron a 37º C. 1.3 Aislamiento y amplificación viral o reactivación de cepas: Para el aislamiento viral desde muestras de sangre y para la reactivación de los aislados virales conservados en el laboratorio de Virología de la Facultad de Ciencias Veterinarias de la Universidad de Chile se realizaron pasajes en monocapas de células MDBK. Para ello, 200 µL de suero o lisados de células infectadas con el virus se inocularon sobre monocapas de células MDBK por 1 hora a 37° C, luego de lo cual, sobre el inóculo viral se agregó 2 mL de medio MEM con suero equino 5% y se incubó a 37° C por 72 horas. Para llevar a cabo un segundo pasaje, a las 72 horas de incubación las células con el medio de cultivo se congelaron/descongelaron por tres veces, de tal manera de lisar las células y liberar el virus al medio de cultivo. Luego de lo cual se repitió el procedimiento detallado anteriormente, pero ahora con 200 µL del lisado celular. Cada cepa fue sometida al número de pasajes necesario para obtener un 50-75% de la monocapa celular infectada con el VDVB. Las cepas se inocularon sobre monocapas de cultivos de células MDBK, libres de infección por el VDVB por 72 horas a 37º C. Luego de cinco infecciones sucesivas, en el sexto pasaje del inóculo se determinó la presencia del virus por inmunofluorescencia directa. 1.4.- Detección de las cepas de VDVB por inmunofluorescencia directa: El sexto pasaje en cultivo celular fue llevado a cabo en células crecidas en laminillas de vidrio (dentro de tubos Leighton) por 3-5 días a 37º C, para detectar antígenos virales por prueba de inmunofluorescencia directa. Luego del pasaje, las laminillas con células inoculadas fueron lavadas con solución tampón PBS (pH 7,6 0,01M), fijadas con acetona a -20º C durante 10 minutos, secadas al ambiente y congeladas a -20º C hasta la realización de la prueba. Las laminillas congeladas fueron rehidratadas con solución PBS (pH 7,6 0,01M ) y posteriormente incubadas 30 minutos a 37º C, en cámara húmeda con anticuerpos policlonales específicos para Pestivirus conjugados con fluoresceína (BVD FITC Antiserum, PA 0205, CVL. Weybridge) en una proporción de 4% de conjugado fluorescente, 3% de Azul de Evans (como contra-tinción) y 93% de PBS (pH 7,6 0,01M). Posterior a la incubación, se eliminó el exceso de solución de conjugado y se procedió a 3 lavados sucesivos de las monocapas celulares con solución tampón PBS (pH 7,6 0,01M) y un último lavado con agua destilada. Finalmente, las laminillas fueron secadas a 37º C y montadas en portaobjetos con el reactivo PermaFluorTM (Termo Electron Corporation). La visualización de la inmunofluorescencia se realizó con un microscopio de fluorescencia Nikon Optiphot-2 con aumento de 400x. La positividad de las muestras se determinó por inmunorreactividad en el citoplasma. En cada ensayo se incluyeron controles positivos (laminillas inoculadas con la cepa NADL de VDVB) y negativos (laminillas sin inocular) de infección. 1.5.- Determinación de la eficiencia replicativa del aislado CH511 y otros aislados autóctonos de distintos subgrupos de VDVB en cultivos de células MDBK: Las cepas fueron evaluadas en cuanto a su cinética del ciclo infectivo viral, eficiencia de síntesis de viriones por ciclo infectivo, y diseminación célula a célula tal como se describe a continuación: 1.5.1.- Ciclo infectivo viral: Para determinar los parámetros, cinética del ciclo infectivo viral y eficiencia de síntesis de viriones se realizó una infección sincronizada de células de la línea MDBK con los virus obtenidos del aislamiento y reactivación de los aislados nacionales del VDVB. Para ello, a monocapas de células MDBK 80% confluentes previamente sembradas en microplacas de 24 pocillos (NUNC®) a una concentración de 200.000 células/mL se les retiró cuidadosamente el medio de cultivo MEM por volteo, se lavaron con 200 µL de solución salina A de Puck y se retiró la solución salina, luego se infectaron con 1 DICT50 virus/célula y 0,05 DICT50 virus/célula de cada uno de los virus en estudio para la determinación de sus curvas de multiplicación de un paso y múltiples pasos, respectivamente. Luego de adsorber los virus por 60 minutos a 4º C se retiró el inóculo, la monocapa se lavó con PBS pH 7,2 a 4º C y luego se agregó medio de cultivo MEM a 37º C suplementado con suero equino (5% y 2,5% para curva de multiplicación de un paso y múltiples pasos respectivamente) para iniciar la infección viral. Para la determinación de la curva de multiplicación de un paso de cada cepa se cosechó el sobrenadante y las células a las 3-6-9-12-15-18-21-24-27-30-33 y 36 horas postinfección (p.i.) y para la curva de multiplicación de múltiples pasos se cosechó a las 12-24-36-48-60-72-84-96 horas p.i. Para esto, luego del tiempo de incubación se retiró el sobrenadante del pocillo y se guarda en un tubo de microcentrífuga o Eppendorf de 1,5 mL , la monocapa se lava con 200µL de medio de cultivo MEM sin suero equino el que luego se retiró y juntó con el sobrenadante guardado en el tubo de microcentrífuga, luego se agregaron 500µL de tripsina-verseno (calentada a 37°C), se incubó por 20 minutos a 37°C en ambiente húmedo para desprender las células del pocillo, las células así desprendidas se sacaron del pocillo y se pusieron en un tubo de microcentrífuga, se centrifugaron (Biofuge primo cell, Heraeus®) a 2000xg por 20 minutos a 4°C, se eliminó la tripsina-verseno el sedimento de células se resuspendieron con el medio de cultivo MEM previamente guardado y se congeló a -20° C. Luego el producto se sometió a 2 ciclos más de congelamiento/descongelamiento con el propósito de producir lisis celular y se guardó a -20° C hasta ser titulado por el método de Inmunoperoxidasa Indirecta (IPI). 1.5.2.- Determinación del título viral mediante la titulación de la infecciosidad de los aislados virales: Para medir la capacidad infecciosa de los aislados virales se usaron microplacas de 96 pocillos (NUNC®), en las cuales 24 horas antes se sembró aproximadamente 15.000 células, contenidas en 100 ul de MEM adicionado de un 8% de suero equino, por cada pocillo. De cada aislado viral se realizaron diluciones seriadas en base 10, desde 1/10 a 1/106 en MEM. Previo a la inoculación de las distintas diluciones, se retiró el MEM de las monocapas celulares y se inoculó 50 μL de cada dilución en cuatro pocillos. Después de incubar por 60 minutos en ambiente húmedo a 37° C con 5% de CO2, se repuso el MEM adicionado de un 2% de suero equino y se incubó por un periodo de 72 horas en las mismas condiciones. La presencia de virus en las células se verificó aplicando la prueba de inmunoperoxidasa indirecta (IPI) y el título del virus se calculó por el método de Reed y Müench y representó el valor recíproco de la dilución viral en que haya infección en el 50% de los cultivos inoculados, y se expresó en dosis infectante de cultivo de tejido 50% (DICT50). 1.5.3.- Determinación de antígenos del VDVB por Prueba de Inmunoperoxidasa Indirecta (IPI): Las monocapas de células crecidas en microplacas, infectadas con las distintas diluciones virales y después de un periodo de incubación de 72 horas fueron lavadas con 100 μL de solución “buffer” fosfato pH 7,6 0,01M, por cinco minutos, luego fueron fijadas con 200 μL de acetona al 20% en PBS 7,6 por un período de 30 minutos a temperatura ambiente. Transcurrido este tiempo se retiró la acetona y se dejaron secar a temperatura ambiente por 24 horas. Posteriormente, las monocapas celulares fijadas en las microplacas, fueron incubadas por 10 minutos con 50 μl de solución de lavado (0,9 mL tween 80 25%/400 mL de PBS pH 7,6). Luego, se retiró la solución de lavado y se adicionó 50 μl de una mezcla de cuatro anticuerpos monoclonales (WB103, WB112, WB166, WB214), dirigidos contra epítopes de la glicoproteína de la envoltura E2 y contra la proteína no estructural NS2-3, ambas comunes para todos los pestivirus (Veterinary Laboratories Agency) dejando incubar por 60 minutos a temperatura ambiente. Posterior al periodo de incubación, se realizó dos lavados de cinco minutos cada uno con 50 μl de PBS pH 7,6. Se adicionó 50 μL de inmunoglobulina de cabra anti IgG de ratón (Goat anti-mouse IgG (H+L) conjugada con la enzima peroxidasa de rábano picante (horseradish peroxidase (HRP) G21040, Invitrogen®) y se mantuvo en incubación por otros 60 minutos. Se repitieron los dos lavados de cinco minutos cada uno con PBS pH 7,6 y se adicionó 50 μL de una mezcla de DAB (3,3 Diaminobenzidine tetrahydrochloride, Sigma-Aldrich®) 0,6mg/mL en presencia de perborato de sodio tetrahidratado (BNaO3.4H2O, Fluka®) 0,4mg/mL en PBS pH 7,6. Las microplacas se incubaron por 10 minutos a temperatura ambiente hasta su posterior observación en un microscopio invertido marca Nikon®, modelo Eclipse TS-100, con aumento de 100x y 400x, junto con controles positivos (células inoculadas con cepa NADL) y negativos (no inoculados), paralelamente realizados. La presencia de antígenos virales en las monocapas celulares se hizo evidente debido a que en ellas se formó un producto insoluble de color marrón que se visualizó microscópicamente en el citoplasma celular, otorgándole a aquellos pocillos la condición de positivos (+). Según este criterio, los pocillos con monocapas ausentes de coloración citoplasmática fueron consideradas negativas (-). 1.5.4.- Determinación del rendimiento viral: Para cada virus en estudio se determinó la cantidad de viriones presentes en los cultivos celulares al momento en que termina el primer ciclo infectivo. La eficiencia de síntesis de viriones para cada aislado viral se obtuvo calculando el número de viriones sintetizados por célula infectada. 1.5.5.- Análisis de la Curva de multiplicación de un paso: de los resultados obtenidos para cada aislado viral en la curva de multiplicación de un paso se determinaron las siguientes variables, para evidenciar diferencias en el comportamiento replicativo de los aislados: A.- Periodo de eclipse: corresponde al tiempo transcurrido desde el final del período de adsorción (tiempo 0) y el primer tiempo donde se observa producción de viriones. B.- Virus residual: corresponde al título de virus infeccioso presente en el medio de cultivo extracelular, 3 hrs. después del periodo de adsorción y correspondería a virus adsorbido que no ingresó al interior de las células. C.- Periodo de síntesis de viriones: corresponde al tiempo transcurrido desde el inicio de la producción de viriones (término del período de eclipse) hasta el tiempo del título máximo logrado (duración del ciclo infectivo). D.- Velocidad de producción de virus infeccioso: corresponde al cuociente entre la producción máxima de viriones y la duración del ciclo infectivo. 1.5.6 Análisis de las pendientes de las curvas de crecimiento de un paso y múltiples pasos: se realizó una prueba de t para evaluar si existen diferencias significativas en las pendientes (b) de las curvas en el sector de crecimiento exponencial tanto para la curva de 1 paso como la de múltiples pasos, considerando un p< 0,05 (Ver en anexo Tabla Nº 2). Los períodos analizados corresponden en la cinética de un paso entre las 9 y 36 hpi. y para la curva de multiplicación de multipes pasos entre las 12 y 48 hpi. [182]. 1.5.7.- Caracterización de la diseminación célula a célula de los distintos aislados virales: Con cada uno de los virus se infectaron monocapas confluentes de células MDBK. Las células se infectaron con 0,1 DICT50 virus/mL del aislado viral correspondiente y se incubaron a 25º C por 60 minutos. Luego de la incubación, las células fueron cubiertas con un medio de cultivo semisólido para restringir y observar preferentemente la diseminación célula-célula [64, 183] y se incubó a 37º C por 72 horas. Una vez cumplido el tiempo de incubación, las células infectadas se visualizaron por la prueba de IPI (protocolo descrito anteriormente). La diseminación de la infección viral se evaluó a través del diámetro de los focos observados en el cultivo. 2.- Identificar zonas genómicas de las regiones 5’ NCR, 3’ NCR, Erns, E2 y NS3 como posibles responsables de las características replicativas de la cepa CH511. Para el cumplimiento de este objetivo se realizó una comparación de las secuencias nucleotídicas y aminoacídicas de regiones genómicas de 5’NCR, 3’NCR, Erns, E2 y NS3 de las diez cepas autóctonas en relación a la cepa de laboratorio NADL con el propósito de identificar probables marcadores moleculares en la cepa chilena CH511 que pudieran ser responsables de la mayor eficiencia replicativa de este aislado, observada en un estudio anterior [181]. Para el análisis se realizó una amplificación de secuencias genómicas de 5’NCR, 3’NCR, Erns, E2 y NS3 de las diez cepas autóctonas por RT-PCR (Transcripción Reversa - Reacción en Cadena de la Polimerasa) y posterior secuenciación nucleotídica, para finalmente hacer el análisis genético y aminoacídico. 2.1 Amplificación por RT-PCR de secuencias genómicas de las regiones 5´NCR 3’NCR, Erns, E2 y NS3 de las cepas de VDVB en estudio. 2.1.1 Extracción de ARN desde lisados celulares infectados con las cepas de VDVB en estudio: monocapas de células infectadas con cada una de las cepas en estudio fueron congeladas y descongeladas tres veces, con el fin de lisar las células y liberar las partículas virales. Luego de esto, la suspensión fue centrifugada a 1500 xg por 5 minutos y se tomaron 250 µL del sobrenadante, el cual se agregó a un tubo Eppendorf con 750 µL de Trizol LS (Invitrogen), se procedió a pipetear varias veces y se incubó por 5 minutos a temperatura ambiente. Luego, se agregó 400 µL de cloroformo y, luego de agitar en vortex por 15 segundos, se incubó a temperatura ambiente por 5 minutos, después de lo cual se centrifugó a 12.000 xg por 15 minutos. Posteriormente, en otro tubo se mezcló 500 µL del sobrenadante obtenido de la centrifugación, con 50 µL de ARN de levadura (1 mg/mL) y 550 µL de isopropanol, incubando a temperatura ambiente por 10 minutos, después de lo cual se centrifugó a 12000 xg durante 10 minutos. Se eliminó el sobrenadante, y el “pellet” resultante se lavó tres veces con 1 mL de etanol al 75%, agitando en vortex por 15 segundos y centrifugando a 7500 xg por 5 minutos. Finalmente se dejó secar el ARN por 10 minutos y se resuspendió en 50 µL de agua destilada estéril, libre de nucleasas. Luego, el ARN se incubó a 55-60º C por 10 minutos, se agitó en vortex y se guardó a -20º C, hasta su posterior utilización en la reacción de RT-PCR. 2.1.2 RT-PCR de las secuencias de regiones 5´NCR 3’NCR, Erns, E2 y NS3 de las cepas de VDVB en estudio: la síntesis del cDNA y su amplificación se realizó mediante la técnica de RT-PCR de un paso utilizando el kit SuperScript IIITM one step /Platinum Taq polimerase® (Invitrogen). Los partidores utilizados para la amplificación de secuencias de las regiones genómicas fueron elegidos según lo descrito por Vilcek et al., 1994 para 5´NCR, por Vilcek et al., 1999 para 3’NCR, por Hulst et al., 1994 para Erns, por Tajima et al., 2001 para E2 y NS3 se resumen en la Tabla Nº 2 junto con la longitud de los templados esperados para cada sector del genoma viral. Tabla Nº 2. Partidores utilizados para RT-PCR de secuencias de las regiones 5´NCR, 3’NCR, Erns, E2 y NS3 de las cepas de VDVB en estudio. Región genómica VDVB Partidores Secuencia nucleotídica 5'-3' Longitud del templado (pb) 5’NCR 324s ATGCCCTTAGTAGGACTAGCA 288 326a TCAACTCCATGTGCCATGTAC Erns UTR3-1F ACATACCTGA(C/T)AAAGGCT(A/T)TACATTACA 420 UTR3-1R TAGACGTCGGG(C/T)GT(A/T)TCCTC E2 E2fs ACTTTGAATTTGGACTYTGC 699 E2ra TCCAGGTCAAACCARTATTG *NS3 NS3F GGGCCTGCCGTGTGTAAGAAGA 2151 NS3R ACTGAAGCAAGTGACCGGGTTG 3’NCR E0F ATGAAAGCCCTGTTGGCATGGGCA 786 E0R CTAGATGTAACCAAGCCTCCGTTC *: los partidores de NS3 fueron diseñados según la secuencia de la cepa de referencia NADL Cada muestra para RT-PCR se realizó con un volumen final de 25 uL con una concentración de reactivos descrita en la Tabla Nº 3 y con un protocolo de RT-PCR como se observa para cada sector genómico en la Tabla Nº 4. Para todos los análisis de las muestras para RT-PCR se uso como control positivo muestras de cultivo inoculadas con la cepa NADL y control negativo muestras de cultivo sin inocular. Tabla Nº 3. Concentraciones utilizadas para la prueba de RT-PCR de secuencias de las regiones 5´NCR, 3’NCR, Erns, E2 y NS3 de las cepas de VDVB en estudio Reactivos 5’NCR Erns E2 NS3 3’NCR Muestra ARN viral 2 uL 2 uL 1 uL 2 uL 2 uL Mezcla de Reacción 2x 12,5 μL 12,5 μL 12,5 μL 12,5 μL 12,5 μL Sulfato de Mg2+ 2 uL (5 mM) -o- -o- -o- 2 uL (5 mM) Partidor sentido 1 uL (10 uM) 1 uL (10 uM) 1 uL (10 uM) 1 uL (10 uM) 1 uL (10 uM) Partidor antisentido 1 uL (10 uM) 1 uL (10 uM) 1 uL (10 uM) 1 uL (10 uM) 1 uL (10 uM) Mezcla de Enzimas1 1 uL 1 uL 1 uL 1 uL 1 uL H20 PCR 5,5 uL 7,5 uL 8,5 uL 7,5 uL 5,5 uL Volumen Final 25 uL 25 uL 25 uL 25 uL 25 uL 1: SuperScript IIITM /Platinum Taq polimerase Tabla Nº 4. Protocolo utilizado en temperaturas y tiempos para la técnica de RT-PCR de secuencias de las regiones 5´NCR, 3’NCR, Erns, E2 y NS3 de las cepas de VDVB en estudio. Etapa del protocolo 5’NCR Erns E2 NS3 3’NCR Transcripción reversa 50º C por 30 min1. 50º C por 30 min. 50º C por 30 min. 50º C por 30 min. 50º C por 30 min. Inactivación Enzima SuperScript IIITM * 94º C por 3 min. 94º C por 3 min. 94º C por 3 min. 94º C por 3 min. 94º C por 3 min. Denaturación** 94º C por 30 seg2. 94º C por 30 seg. 94º C por 30 seg. 94º C por 30 seg. 94º C por 30 seg. alineamiento** 55º C por 30 seg. 58º C por 2 min. 50º C por 1 min. 60º C por 2 min. 56º C por 1 min. extensión ** 68º C por 1 min. 68º C por 1 min. 68º C por 1 min. 68º C por 2 min. 68º C por 1 min. Extensión final 68º C por 5 min. 68º C por 5 min. 68º C por 5 min. 68º C por 10 min. 68º C por 5 min. Total ciclos de PCR 40 40 40 40 40 *: que corresponde además a la denaturación inicial **: las tres etapas conforman un ciclo de PCR 1: minuto 2: segundo 2.1.3 Electroforesis en gel de agarosa: los fragmentos de ADN amplificado por RT-PCR para cada secuencia se visualizó por electroforesis en gel de agarosa al 2% para los templados de las regiones 5’ NCR, 3’NCR, Erns y E2; y 1% para la región amplificada de NS3 en tampón TBE, con posterior tinción con bromuro de etidio 1 µg/mL. Para ello, 0,5 (para 2%) ó 0,25 (para 1%) gramos de agarosa se fundieron en 25 mL de tampón TBE a 100° C. Después de enfriar a 55º C la solución se virtió en la cubeta de la cámara de electroforesis y se dejó hasta que gelificara, luego de lo cual se cubrió hasta 1 mm sobre la superficie del gel con tampón TBE. Las muestras a cargar en el gel correspondieron a 5 µL de la reacción de RT-PCR y 1 µL de tampón de electroforesis. Como estándar de peso molecular se usó un ADN “ladder” de 100 pb (Invitrogen). El gel se sometió a una electroforesis de 120 V por 35 minutos para los templados de las regiones 5’ NCR, 3’NCR, Erns y E2 y 100 V por 45 minutos para el templado de la región NS3 de VDVB. Una vez concluida la electroforesis el gel fue incubado en una solución de bromuro de etidio 1 µg/mL por 20 minutos y luego en agua destilada por 5 minutos. Los fragmentos de ADN en el gel se observaron en un transiluminador con luz UV. 2.1.4 Purificación del amplicón desde la reacción de RT-PCR: Para purificar el amplicón se usó el kit “QIAquick PCR Purification” (QIAGEN). Brevemente, a un volumen de reacción de PCR se agregó cinco volúmenes de tampón PBI y se cargó en una columna QIAquick inserta en un tubo de 2 mL. Luego de centrifugar a 17.900 xg durante 1 minuto y eliminar el líquido del tubo, se agregó 750 µL de tampón PE a la columna y se centrifugó a 17.900 xg por 1 minuto nuevamente. Luego de eliminar el líquido del tubo, la columna se centrifugó nuevamente y se colocó en un tubo de 1,5 mL donde se procedió a agregar 50 µL de agua destilada. Luego de incubar a temperatura ambiente por 1 minuto se centrifugó por 1 minuto para eluir el ADN. En caso de tener una concentración mayor de 10 ng/µL se secuenciaron directamente ambas cadenas de ADN usando los mismos partidores empleados en la reacción de RT-PCR. En aquellos casos en que la concentración del amplicón obtenido fue menor de 10 ng/µL, el amplicón se clonó en el vector pGEM T-Easy, el plasmidio se multiplicó en bacterias E. coli y luego se secuenció el amplicón inserto en el plasmidio purificado. 2.1.5 Cuantificación del amplicón purificado: el ADN purificado con el kit QIAquick fue cuantificado por electroforesis en gel de agarosa con posterior tinción con bromuro de etidio. Para ello, la muestra sometida a electroforesis contenía 1 µL del amplicón purificado, 4 µL de agua y 1 µL de tampón muestra. Como estándar de masa se utilizó ADN del fago ØX174 digerido con HaeIII (FERMENTAS). Las muestras de ADN a cuantificar junto con el estándar de masa se sometieron a electroforesis en gel de agarosa 2% en tampón TBE a 100V por 30 minutos. Posteriormente, el gel se sumergió en una solución de bromuro de etidio 1 µg/mL por 20 minutos y luego en agua destilada por 5 minutos. En un transiluminador con luz UV los amplicones se cuantificaron comparando la intensidad de su fluorescencia, con la fluorescencia de los fragmentos de ADN de masa conocida del estándar presente en el gel. 2.1.6 Clonación del amplicón purificado en el vector pGEM-T Easy: Los amplicones purificados con una concentración menor de 10 ng/µL fueron clonados en el vector pGEM-T Easy (PROMEGA) para aumentar la cantidad del amplicón antes de ser secuenciado. Para ello, 5-10 ng del amplicón purficado se clonó en 50 ng del vector pGEM-T Easy con 3 Unidades de la enzima T4 ADN Ligasa a 4° C por 16 horas. Posteriormente, 2 µL de cada reacción de clonación se incubó a 4° C por 20 minutos con 50 µL de células competentes JM109 recién descongeladas. Luego se aplicó un shock térmico de 42° C por 50 segundos e inmediatamente se volvió a incubar las células a 4° C por 2 minutos. A continuación se agregó 950 µL de medio SOC (extracto de levadura 5 g/l, triptona 20 g/l, NaCl 10 mM, KCl 2,5 mM, glucosa 20 mM, Mg+2 20 mM, pH 7,0) a temperatura ambiente y se incubó a 37° C por 1,5 horas en un agitador orbital termorregulado a 150 rpm. Cumplido el tiempo, 100 µL de cada cultivo transformante se sembró en placas de agar LB/ampicilina/IPTG/X-Gal (triptona 10 g/l, extracto de levadura 5 g/l, NaCl 5 g/l, ampicilina 100 µg/mL, IPTG 0,5 mM, X-Gal 50 mg/mL, pH 7,0) y se incubó 16-24 horas a 37º C. Las colonias blancas poseían el vector pGEM-T Easy con el inserto de ADN y las colonias azules contenían el vector sin el inserto. 2.1.7 Obtención del plasmidio purificado: diez colonias blancas fueron seleccionadas desde las placas LB/Ampicilina/ IPTG/X-Gal. Una parte de la colonia se sembró en una placa de agar LB/Ampicilina (triptona 10 g/l, extracto de levadura 5 g/l, NaCl 5 g/l, ampicilina 100 µg/mL, pH 7,0) y otra parte de la colonia se colocó en tubo con 50 µL de agua destilada estéril. Las colonias bacterianas colocadas en agua se incubaron por 5 minutos a 99° C para lisarlas y liberar el ADN y se centrifugaron a 7.500 xg por 15 minutos. El lisado bacteriano se utilizó como muestra para realizar un PCR de colonia, de tal manera de detectar la presencia del amplicón en el plasmidio. La reacción de PCR se llevó a cabo bajo las siguientes condiciones: Tris-HCl 20 mM, KCl 50 mM, MgCl2 1,2 mM, dNTP 0,2 mM, Taq Polimerasa Platinum (Invitrogen) 1 U y los partidores específicos para la secuencia genómica de VDVB clonada en una concentración de 0,4 μM cada uno (sentido y antisentido). La reacción de amplificación se llevó a cabo bajo las siguientes condiciones: 40 ciclos de 94° C por 30 segundos, 55° C por 30 segundos y 72° C por 1 minuto. Luego, los tubos se incubaron a 72° C por 10 minutos. El ADN amplificado se visualizó por electroforesis en gel de agarosa al 2% en tampón TBE, con posterior tinción con bromuro de etidio 1 µg/mL. Aquellas colonias que dieron RT-PCR (+), es decir aquellas que presentaban el plasmidio con el amplicón insertado, fueron sembradas en 10 mL de medio líquido LB/Ampicilina e incubadas por 16 horas a 37° C en un agitador orbital termoregulado a 200 rpm. El plasmidio se purificó desde las bacterias transformadas utilizando el kit “GeneJET Plasmid Miniprep” (Fermentas). Para ello, 5 mL de medio de cultivo se centrifugó a 6.800 xg por 2 minutos a temperatura ambiente y se eliminó el sobrenadante. Las bacterias sedimentadas se resuspendieron en 250 µL de solución de resuspensión agitando por pipeteo. Luego se agregó 250 µL de solución de lisis, se mezcló suavemente por inversión y se incubó a temperatura ambiente por 2 minutos. A continuación se agregó 350 µL de solución de neutralización y se mezcló por inversión varias veces hasta formar un precipitado floculento, el que se precipitó a 14.000 xg por 5 minutos. El sobrenadante se cargó en una columna del kit inserta en un tubo de 2 mL y luego de centrifugar a 14.000 xg por 1 minuto a temperatura ambiente se eliminó el líquido de la columna. 500 µL de solución de lavado se agregó a la columna y luego de centrifugar a 10.000 xg por 1 minuto se eliminó el líquido. El lavado se repitió 1 vez más. Posteriormente, la columna vacía se centrifugó a 14.000 xg por 1 minuto y luego de colocar la columna en un tubo de 1,5 mL se agregó 50 µL de agua estéril desionizada directamente en la matriz de la columna. Luego de incubar por 2 minutos a temperatura ambiente se centrifugó a 14.000 xg por 2 minutos para eluir el plasmidio. El plasmidio se guardó a -20° C. El plasmidio purificado fue cuantificado por electroforesis en gel de agarosa con posterior tinción con bromuro de etidio, de la misma manera como se realizó con el amplicón purificado, metodología descrita anteriormente. 2.2 Análisis filogenético de las secuencias de las regiones 5´NCR, 3’NCR, Erns, E2 y NS3 de las cepas de VDVB en estudio. Los productos purificados fueron enviados para el proceso de secuenciación a la empresa Genytec Ltda. El análisis filogenético molecular de las secuencias nucleotídicas obtenidas por RT-PCR se realizó usando el programa MEGA de análisis bioinformático. Para ello, las secuencias nucleotídicas obtenidas se alinearon para cada una de las regiones por separado mediante el programa ClustalW® 2.0 [184], Una vez realizado el alineamiento múltiple, se procedió a la construcción de árboles filogenéticos tanto para cada secuencias analizada mediante el programa MEGA® 3.1 [185]. Se utilizó para esto el método de “Neighbor Joining” [186], tomando como modelo de sustitución de bases el método de dos parámetros de Kimura [187] y para probar la fuerza del análisis y la significancia del ordenamiento se realizó un “bootstrap” de 1000 réplicas. 2.3 Análisis genético y aminoacídico de las secuencias de las regiones 5´NCR, 3’NCR, Erns, E2 y NS3 de las cepas de VDVB en estudio. Las secuencias obtenidas por la técnica de RT-PCR, y posterior secuenciación, de las regiónes 5’NCR 3’NCR, Erns, E2 y NS3 de las cepas de VDVB en estudio fueron analizadas tanto nucleotídicamente como aminocídicamente (secuencias obtenida a través del programa MEGA® 3.1 de análisis bioinformático), cuando el análisis correspondía, con el objetivo de identificar marcadores moleculares de relevancia que pudieran tener implicancia en las diferencias encontradas en la infección de las cepas en estudio de buscar secuencias que pudieran ser responsables de las diferencias replicativas que pudieran presentar las cepas en estudio. Además, para el análisis de la estructura secundaria de 5’y 3’ NCR se utilizó el Programa Mfold®. RESULTADOS 1.- Determinar la eficiencia replicativa del aislado nacional CH511 (genotipo 1, subtipo j) con respecto a virus del mismo y otros subtipos presentes en el país. Para la comparación de las regiones genómicas en estudio, se utilizaron nueve cepas autóctonas más la cepa de laboratorio NADL. Los nueve aislados nacionales se amplificaron en cultivo celular de la línea celular MDBK y se determinó la cinética del ciclo infectivo viral y la eficiencia replicativa de cada una. Para luego en el objetivo específico Nº 2 proceder a secuenciar y analizar filogenéticamente la región 5’ NCR, 3’ NCR, Erns, E2 y NS3 del VDVB y con esta información identificar los posibles marcadores asociados a las diferencias observadas en la infección viral. 1.1.- Aislados seleccionados El grupo de cepas seleccionadas permitió tener un número de secuencias pertenecientes a todos los subgrupos existentes en el país y por lo tanto representantes de toda la variabilidad genética para la comparación biológica y genética posible para la cepa CH511 en Chile, con el fin de detectar los posibles marcadores moleculares que pudieran responsables de la mayor eficiencia replicativa de las cepas de VDVB. De las diez cepas, cuatro fueron aisladas en un estudio anterior (cepa 113 de genotipo VDVB-1b, cepa 511 de genotipo VDVB-1j; y una cepa de genotipo VDVB-2a 809) [181], dentro de ellas se ubica la cepa chilena CH511 (Nº GenBank AF356504) aislada en 1993 en el laboratorio de Virología de la Facultad de Ciencias Veterinarias y Pecuarias de la Universidad de Chile de un feto abortado y de probada mayor eficiencia replicativa. A estas, se añadieron seis nuevas cepas (2 cepas genotipo VDVB-1a, 916 y 1091; 1 cepa genotipo VDVB-1b, 1025; 1 cepa genotipo VDVB-1j, 1087; y 2 cepas genotipo VDVB-1i, 921 y 1068) (Proyecto Fondecyt Nº 1060581), para el análisis genómico. A estas cepas se debe añadir en el análisis la secuencia de las regiones genómicas de la cepa de referencia NADL (ATTC VR-1422) de VDVB que pertenece al genotipo 1a. Los diez aislados utilizados en este estudio, para el estudio genómico y biológico, fueron seleccionados de un grupo de 45 aislados que tenían distintas procedencias y temporalidad en el aislamiento (ver Tabla en anexo Nº1, se destacan aislados seleccionados). A los 45 virus aislados y reactivados se les extrajo el genoma viral y se procedió a amplificar la región 5’NCR por RT-PCR, de acuerdo a las condiciones señaladas en Materiales y Método. Los partidores utilizados: 324 (5’-ATGCCCTTAGTAGGACTAGCA-3’) y 326 (5’-TCAACTCCATGTGCCATGTAC-3’), sintetizaron un fragmento de ADN de 288 pb, de los aproximadamente 385 pb que tiene la región 5’NCR. Todos los virus generaron un fragmento de ADN del tamaño esperado. En la mayoría de los casos los amplicones fueron sometidos a secuenciación directa. Sin embargo, en algunos virus fue necesario clonar el amplicón en el vector pGEM T-Easy para ser secuenciados. Para la secuenciación se utilizaron los mismos partidores usados en la reacción de RT-PCR. Las secuencias nucleotídicas de los 45 virus fueron analizadas genéticamente en nuestro laboratorio por filogenia molecular usando herramientas de bioinformática. Para ello, las secuencias nucleotídicas se alinearon entre sí y con secuencias nucleotídicas de genotipos y subgrupos virales del VDVB, disponibles en bancos de datos internacionales (GenBank), utilizando el programa ClustalW 2.0. Posteriormente se realizó el análisis filogenético de las secuencias nucleotídicas usando el programa MEGA con los métodos de Kimura 2 parámetros y Neighbor Joining. Los resultados del árbol filogenético se pueden observar en la Figura Nº 5, siendo destacados los aislados seleccionados (♦) para la evaluación biológica y genética. 1.2.- Determinación de la eficiencia replicativa en curvas de multiplicación de un paso, múltiples pasos y efieciencia de síntesis de virus infecciosos de las cepas en estudio Para conocer la cinética de crecimiento viral de los aislados de VDVB seleccionados para este estudio, previo a la inoculación de los virus en los cultivos celulares, se debió cuantificar la infecciosidad de cada uno, de modo de inocular una multiplicidad de infección 1 y 0,05 DIC50 / célula en una población aproximada de 150.000 células. Las células se infectaron con la misma cantidad de virus para todos los aislados virales, para que los resultados obtenidos fueran comparables entre los distintos virus. El título viral inicial fluctuó entre 105,5 a 107 DIC50/ 50µL, de esta manera se calcularon los volúmenes de infección para la caracterización biológica de cada cepa utilizada en el estudio. El título y el genotipo/subgrupo de cada aislado seleccionado está representado en la Tabla N°5 Tabla N°5. Genotipo/subgrupo y título viral de los aislados del VDVB. Aislado viral Genotipo/Subgrupo Título viral 916 VDVB 1a 6.5 DIC50/mL 1091 VDVB 1a 6.0 DIC50/mL 113 VDVB 1b 6.0 DIC50/mL 1025 VDB 1b 6.5 DIC50/mL 921 VDVB 1i 6.0DIC50/mL 1068 VDVB 1i 6.0DIC50/mL 511 VDVB 1j 7.0DIC50/mL 1087 VDVB 1j 7.0DIC50/mL 809 VDVB 2a 7.0 DIC50/mL En la cinética de un paso, cada 3 horas se determinó el título de viriones totales (viriones libres y asociados a células), la duración del ciclo infectivo (tiempo en el cual se estabiliza el título de viriones libres) (Tabla Nº 6) y la eficiencia de síntesis de viriones (Tabla Nº 7). En la curva de multiplicación de un paso (Figura Nº 1) se observa que las cepas utilizadas en el estudio presentan una gran variabilidad en la cinética de crecimiento. En cuanto a la duración del ciclo infectivo se observan dos grupos de virus. En el primer grupo se ubican los virus que se demoran entre 15 a 21 horas post infección (hpi) para completar su ciclo infectivo (916, 1091, 921, 1068, 511, 1087 y 470) y en el segundo grupo, los virus que se demoran entre 24 a 27 hpi en completarlo, 1025 (27 horas), 113 (30 horas) y 809 (33 horas) (Tabla Nº 6). Los dos virus del subgrupo 1b (113 y 1025) poseen un ciclo infectivo más lento, lo que sugiere una característica específica de los virus de este subgrupo en relación a las cepas 1a(916-1091), 1i(921-1068) y 1j(511-1087) que se ubican en el primer grupo. 1.3.- Determinación de la eficiencia de síntesis de virus infeccioso. En la cinética de un paso, cada 3 horas se determinó el título de viriones totales (que incluye en conjunto viriones libres y asociados a células) y se calculó la duración del ciclo infectivo (tiempo en el cual se estabiliza el título de viriones libres) (Tabla Nº 6) y el rendimiento viral (Tabla Nº 7). Figura Nº 1. Curva de multiplicación de un paso de las cepas de cada subgrupo inoculadas en células MDBK (1 DIC50 virus/célula) En la cinética de múltiples pasos, cada 12 hpi se determinó el título de viriones totales y se calculó la duración de la multiplicación viral (tiempo en el cual se estabiliza el título de viriones) (Tabla 6) y el rendimiento viral medido como título máximos obtenidos en las curvas de multiplicación de un paso y múltiples pasos (Tabla Nº7); o como eficiencia de síntesis parciales y final en la curva de multiplicación de múltiples pasos (destacando las síntesis de virus infeccioso a las 12, 24, 36 horas y al término de la multiplicación viral en la Tabla Nº 14). Con respecto a la duración de la multiplicación viral, al igual que en la cinética de un paso, también se observan dos grupos de virus. En el primer grupo, los virus se demoran entre 36 a 48 hpi para completar la multiplicación viral (511 y 1087) y en el grupo dos, los virus se demoran entre 60 a 72 hpi para completarla (916, 1091, 113, 1025, 921, 1068 y 809). Los dos aislados del subgrupo 1j (511 y 1087) pertenecen al grupo uno, lo que sugeriría una característica específica de los virus de este subgrupo. Estos resultados reflejarían que estas cepas presentan una replicación viral muy eficiente en términos de una rápida diseminación de la infección viral. Por otra parte, nuevamente las cepas 1b se ubican en el grupo que presenta la terminación de la multiplicación viral de manera más tardía. A continuación en la Tabla Nº 6 se muestra el resumen de la duración del ciclo infectivo en la cinética de multiplicación de un paso y la duración de la multiplicación viral en la curva de multiplicación de múltiples pasos, destacándose los tiempos requeridos por las cepas 1b (amarillo) y las cepas 1j (verde). Figura Nº 2. Curva de multiplicación de múltiples pasos de las cepas de cada subgrupo inoculadas en células MDBK (0,05 DIC50 virus/célula) Tabla Nº 6. Duración del ciclo infectivo en una cinética de un paso y duración de la multiplicación viral en una cinética de múltiples pasos para los aislados nacionales de VDVB Cepas de VDVB Duración del ciclo infectivo viral (horas) Duración de la multiplicación viral en una cinética de múltiples pasos 916(1a) 15 60 1091(1a) 18 60 113(1b) 30 72 1025(1b) 27 60 921(1i) 15 60 1068(1i) 18 72 511(1j) 21 36 1087(1j) 18 48 809(2a) 33 72 En cuanto al titulo máximo de virus infeccioso producido en la cinética de multiplicación de un paso, los resultados se pueden observar en la Tabla Nº 7. Nuevamente se evidencian dos grupos, el primero obtiene títulos máximos mayores entre 5.0 y 6.5 DIC50/mL, aquí se incluyen las cepas 1091(1a), NADL (1a), 511(1j) y 1087(1j). En el segundo grupo se ubica el resto de las cepas del estudio 916(1a), 113 y 1025(1b); 921 y 1068(1i); 809(2a), con títulos máximos que oscilaban entre 3.0 y 4.5 DIC50/mL. Nuevamente las cepas del subtipo 1b se ubican en el grupo de menor rendimiento en relación a las cepas 1j. Tabla Nº 7. Título máximo de virus infeccioso obtenido en la curva de multiplicación viral de un paso, para los aislados nacionales de cada subgrupo y la cepa de referencia NADL (LogDIC50/mL) Aislado Subgrupo Título (curva de un paso)* Título (curva de múltiples pasos)* 916 1a 3.0 7.0 1091 1a 6.0 6.1 113 1b 3.5 5.3 1025 1b 4.5 5.8 921 1i 4.5 5.3 1068 1i 4.0 5.6 511 1j 5.0 6.6 1087 1j 6.5 7.1 809 2a 4.5 5.9 *: logDIC50/mL 1.4.- Variables obtenidas del análisis de la curva de multiplicación de un paso: de los resultados obtenidos para cada aislado viral en la curva de multiplicación de un paso se determinaron las siguientes variables, para evidenciar diferencias en el comportamiento replicativo de los aislados: A.- Periodo de eclipse: corresponde al tiempo transcurrido desde el final del periodo de adsorción (tiempo 0) y el primer tiempo donde se observa producción de viriones. Tabla Nº 8. Periodo de eclipse para cada cepa de VDVB analizada Aislado NADL (1a) 916 (1a) 1091 (1a) 113 (1b) 1025 (1b) 921 (1i) 1068 (1i) 511 (1j) 1087 (1j) 809 (2a) Periodo de eclipse (hpi) 9 15 12 12 12 15 18 12 9 24 En general, los aislados se pueden clasificar en dos grupos en cuanto al tiempo requerido para formar nuevos viriones (tiempo de eclipse). En el primer grupo se encuentran los que requieren menor tiempo entre 9 y 12 hpi (cepas NADL, 1091, 113, 1025, 511 y 1087) y en el segundo los que requirieron mas tiempo, entre 15 y 18 horas (916, 921 y 1068). Una de las cepas analizadas fue extremadamente lenta en este aspecto y correspondió a la cepa 809 (Tabla Nº 8). B.- Virus residual: corresponde a las partículas virales presentes en el medio de cultivo extracelular, después del periodo de adsorción y corresponde a virus no adsorbido y no eliminado en el proceso de lavado de las monocapas. Tabla Nº 9. Virus residual de cada cepa nacional de VDVB Aislado NADL (1a) 916 (1a) 1091 (1a) 113 (1b) 1025 (1b) 921 (1i) 1068 (1i) 511 (1j) 1087 (1j) 809 (2a) Virus residual (LogDIC50/mL) 4 1 5 1,5 0 3,5 3 2 2,5 2 En general, los aislados se pueden clasificar en dos grupos en cuanto al virus residual observado en la cinética de multiplicación de un paso, este índice refleja el virus adsorbido pero que no penetra las células del cultivo celular. En el primer grupo se encuentran los que presentan títulos menores de virus residual entre 0 y 2,5 logDIC50/mL (cepas 916, 113, 1025, 511, 1087 y 809) y en el segundo se encuentran los que presentan títulos mayores de virus residual entre 3 y 5 logDIC50/mL (NADL, 1091, 921 y 1068) (Tabla Nº 9). Los que presentan mayores títulos pertenecen al subtipo 1a y 1i, lo que indica que gran cantidad de virus fue adsorbido pero no penetró a las células. C.- Periodo de síntesis de viriones: corresponde al tiempo transcurrido desde el inicio de la producción de viriones (término del período de eclipse) hasta el tiempo del título máximo logrado (duración del ciclo infectivo). Tabla Nº 10. Periodo de síntesis de viriones de cepas nacionales de VDVB en curva de multiplicación de un paso Aislado 916 (1a) 1091 (1a) 113 (1b) 1025 (1b) 921 (1i) 1068 (1i) 511 (1j) 1087 (1j) 809 (2a) Periodo de eclipse (hpi) 3 9 21 18 3 3 12 12 12 En cuanto a este parámetro se distinguen claramente tres grupos (Tabla Nº 10). El primer grupo (cepas 916, 921 y 1068) con un período muy breve de liberación de viriones, 3 horas. El segundo grupo (1091, 511, 1087 y 809) con un período intermedio de liberación de viriones 9 a 12 horas y el tercer grupo (113 y 1025) con el periodo mas largo. Las cepas 1b se ubican en el grupo de más largo periodo de liberación de viriones, lo que es concordante con su mayor duración del ciclo infectivo. D.- Velocidad de producción de virus infeccioso: corresponde al cuociente entre la producción máxima de viriones y la duración del ciclo infectivo, en la curva de multiplicación de un paso (LogDIC50/mL/hora) Tabla Nº 11. Velocidad de producción de virus infeccioso de cepas nacionales de VDVB Aislado 916 (1a) 1091 (1a) 113 (1b) 1025 (1b) 921 (1i) 1068 (1i) 511 (1j) 1087 (1j) 809 (2a) Velocidad de producción de virus infeccioso 67* 55556 105 1171 2108 556 4762 175682 958 *: (DIC50/mL/hora) En base al rendimiento de las cepas en cultivos celulares en la curva de multiplicación de un paso podemos discriminar tres grupos. El primero con menor producción de virus infeccioso por hora entre 67 y 105 DIC50/mL/hora (cepas 916 y 113). Un grupo intermedio que produce entre 556 y 2108 DIC50/mL/hora (cepas 921, 1068, 809 y 1025). Por último, el grupo de mayor eficiencia en el rendimiento de producción de virus infeccioso que produce entre 4762 y 175682 DIC50/mL/hora (511, 1091 y 1087). Nuevamente las cepas 1b se ubican en el grupo de menor rendimiento, en este caso de producción de virus en relación al tiempo transcurrido (Tabla Nº11). Este índice también se calculó para la curva de multiplicación de múltiples pasos: Tabla Nº 12. Eficiencia de síntesis de virus infeccioso de cepas nacionales de VDVB en curva de multiplicación de múltiples pasos Aislado 916 (1a) 1091 (1a) 113 (1b) 1025 (1b) 921 (1i) 1068 (1i) 511 (1j) 1087 (1j) 809 (2a) Eficiencia de síntesis de virus infeccioso (Título de virus infeccioso/ hora) 166667 13239 1749 6635 1051 5529 55423 131449 2771 En base al rendimiento de las cepas en cultivos celulares en la curva de multiplicación de múltiples pasos, podemos discriminar dos grupos. El primero con menor producción de virus infeccioso por hora entre 1749 y 5529 DIC50/mL/hora (cepas 1091, 113, 1025, 921, 1068 y 809). El segundo grupo de mayor eficiencia en el rendimiento de producción de virus infeccioso y que produce entre 55423 y 166667 DIC50/mL/hora (cepas 916, 511 y 1087). Según este parámetro las cepas 1b se ubican en el grupo de menor rendimiento de producción de virus en relación al tiempo transcurrido y las cepas 1j se ubican en el grupo de mayor rendimiento con respecto a este parámetro (Tabla Nº 12). 1.5.- Análisis de las pendientes de las curvas de crecimiento de un paso y múltiples pasos: se realizó una prueba de t para evaluar si existen diferencias significativas en las pendientes (b) de las curvas en el sector de crecimiento exponencial tanto para la curva de 1 paso como la de múltiples pasos, considerando un p< 0,05 (Ver en anexo Tabla Nº 2). Los períodos analizados corresponden en la cinética de un paso entre las 9 y 36 hpi. y para la curva de multiplicación de multipes pasos entre las 12 y 48 hpi [182]. Tabla Nº 13. Comparación de las pendientes obtenidas para las curvas de multiplicación de un paso (entre 9 y 36 hpi) y la curva de multiplicación de múltiples pasos de cepas 1b y 1j autóctonas de VDVB (p< 0,05). Subtipo Aislado viral Pendiente (b) curva de multiplicación de un paso Pendiente(b) curva de multiplicación de múltiples pasos 1b 113 0,0535a* 0,1000a 1b 1025 0,1310c 0.1083a 1j 511 0,1548b,c,d 0,0917b 1j 1087 0,1167b,d 0,0833b *: letras distintas indican diferencias significativas en las pendientes (p<0,05) Para realizar una evaluación de las cepas que tuvieron mayor y menor duración del ciclo infectivo, se realizó una comparación de pendientes de las curvas de la cinética de un paso de las cepas 1b y 1j (Tabla Nº 13). Se comprobó que existen diferencias entre cepas y dentro de cepas: 113-511 (p=0,0003) (Figura Nº 3), 113-1025 (p=0,0106), 113-1087 (p<0,0001), 1025-1087 (p=0,0004)(ver en Anexo Figura Nº 1), no existiendo diferencias entre 511-1087 (p=0,079) y 511-1025 (p=0,1406). Según estos parámetros existe una mayor eficiencia, estadísticamente significativa, en las cepas 511, 1025, 1087 en relación a la cepa 113 que presenta menor eficiencia replicativa. La misma comparación se realizó para la cinética de múltiples pasos, observando que existen diferencias entre los subtipos 1b y 1j: 113-511 (p=0,0065) (Ver en anexo Figura Nº 2), 113-1087 (p=0,0056), 1025-1087 (p=0,0009) (Ver en Anexo Figura Nº 3) y 1025- 511 (p=0,1406), no existiendo diferencias entre 113-1025 (p=0,6109), 511-1087 (p=0,079), o sea no habría diferencias entre las cepas del mismo subtipo. Las cepas 1b en las cinéticas de múltiples pasos tendrían mayor eficiencia replicativa, con respecto a este parámetro, al comparar las pendientes obtenidas de sus curvas de crecimiento en relación a las cepas 1j. Figura Nº 3. Comparación de pendientes de cinética de un paso de las cepas 511 y 113 a través de la prueba t (p<0,05) En cuanto a la eficiencia de síntesis de viriones se observan varios grupos de virus a distintos tiempos post-infección, resultados mostrados en la Tabla Nº 14. Así a las 12 horas de infección se pueden observar 3 grupos: grupo uno (113 y 1025), sin niveles detectables de virus infeccioso; grupo 2 (921, 1068 y 809) con títulos bajos de viriones entre 0,8 a 1,1 logDIC50/mL y grupo 3 (916, 1091, 511 y 1087) con niveles mayores de título de viriones entre 2,9 y 3,8 logDIC50/mL. A las 24 hpi se pueden observar dos grupos, el grupo uno (cepas 113, 1025, 921, 1068 y 809) con títulos que oscilan entre 1,9 y 3,0 logDIC50/mL y grupo 2 (916, 1091, 511 y 1087) con títulos entre 4,0 y 5,6 logDIC50/mL. A las 36 horas de infección también se observan dos grupos, en el primer grupo se ubican las cepas de menor rendimiento (113, 1025, 921 y 809) con títulos entre 3,4 y 3,8 logDIC50/mL y un segundo grupo de cepas con mayor título de virus infeccioso (cepas 916, 1091, 1068, 511 y 1087) que oscilan entre 4,9 y 6,1 logDIC50/mL. Al término de la multiplicación viral, al igual que a las 24 y 36 hpi se distinguen 2 grupos, el grupo uno (virus 113, 1025, 921, 1068 y 809) poseen títulos entre 4,8 y 5,6 logDIC50/mL y el grupo 2 (virus 916, 1091, 511 y 1087) con niveles de viriones de 5,9 a 7.0 logDIC50/mL. En general, observando la producción de virus infeccioso es notable que las cepas 1b (113 y 1025) siempre se ubicaron en los grupos de menor rendimiento. Las cepas de mayor eficiencia, con respecto a este parámetro, fueron las cepas 1a (916 y 1091) y 1j (511 y 1087). Tabla Nº 14. Rendimiento de síntesis de virus infeccioso de aislados nacionales de VDVB a 12, 24, 36 hpi y síntesis final TIEMPO DE INFECCION (hpi) RENDIMIENTO DE SINTESIS DE VIRUS INFECCIOSO POR CEPA(logDIC50/mL) 916 1091 113 1025 921 1068 511 1087 809 12 3,8 2,9 0 0 0,8 1,1 3,5 3,8 1 24 4,9 4 3 2,4 2,9 1,9 4,9 5,6 3 36 6 5,4 3,5 3,8 3,4 4,9 6,1 6,1 3,6 FINAL 7 5,9 5,1 5,6 4,8 5,6 6,3 6,8 5,3 1.6.- Determinación de la la diseminación célula-célula de la infección viral. La diseminación célula-célula de la infección viral se estudió en monocapas de células MDBK cubiertas con un medio de cultivo semisólido, para eliminar la diseminación extracelular del virus. Luego de infectar las células por 72 horas a 37°C, la eficiencia de la diseminación célula-célula de los distintos virus probados se determinó a través del tamaño de los focos infecciosos en las monocapas de células MDBK (Tabla Nº 15). Los resultados permiten distinguir tres grupos de virus. Los virus del grupo uno (511, 1087 y 809) forman focos infecciosos pequeños, de un diámetro de 0.26 a 0.29 mm; los virus del grupo dos (916, 1091, 113, 921 y 1068) con focos infecciosos de tamaño intermedio, de un diámetro de 0,34 a 0.39 mm; y al grupo tres (1025) con focos infecciosos grandes, con un diámetro promedio de 1.63 mm (Tabla Nº 15). En la figura Nº 4 observamos los focos de diseminación de las cepas 511, 113 y 1025. Tabla Nº 15. Diseminación célula-célula de la infección viral de aislados chilenos del VDVB en monocapas de células MDBK cubiertas con un medio de cultivo semisólido. CEPA DE VDVB Diámetro de focos infecciosos (mm) 916 1091 113 1025 921 1068 511 1087 809 0.36 0.39 0.34 1.63 0.39 0.37 0.26 0.28 0.26 Valor promedio obtenido de la medición de 20 focos infecciosos por virus Figura Nº 4. Focos de infección de cepas autóctonas del subtipo 1b y 1j de VDVB en células MDBK (cepa 511, 113 y 1025) En resumen para el objetivo especifico Nº 1 del estudio, los resultados indican que hay algunos virus que completan su ciclo infectivo rápidamente en la curva de multiplicación de un paso (duración del ciclo infectivo), con pendientes en la fase de crecimiento exponencial significativamente mayores (511-1087 vs 113) y formando una gran cantidad de viriones (511 y 1087) y hay otros virus, que les toma más tiempo el ciclo infectivo y forman menos viriones (113 y 1025). Además por ejemplo, en la cinética de múltiples pasos a las 12 horas de infección los virus 113 y 1025 aún no son capaces de formar progenie viral, sin embargo, los virus 511 y 1087 presentan altas cantidades de viriones (3,5 y 3,8 logDIC50/mL, respectivamente) y con títulos de virus infecciosos finales mayores de las cepas 1j en relación a 1b, sin embargo las pendientes de las curvas de crecimiento de las cepas 1b (113 y 1025) son significativamente mayores en la fase exponencial. Aunque este análisis se realizó entre las 12 y 36 horas y puede que haya sido determinado en un tiempo tardío para las cepas 1j que presentaron ciclos replicativos mas precoces en la curva de multiplicación de múltiples pasos (36 y 48 para cepas 1j vs 60 y 72 hrs para cepas 1b). Por otro lado para la cinética de un paso, el periodo de eclipse, se situó entre 6 y 12 hrs., a excepción de la cepa 809 en que fue de 21 hrs., por lo que no habría diferencias entre las cepas 1b y 1j. En cuanto al virus residual las cepas 1b y 1j se ubican en el grupo de menor título de virus infeccioso. Con respecto al período de síntesis de viriones las cepas 1b se ubican en el grupo de mayor periodo (21 hrs. para 113 y 18 hrs. para 1025) y las cepas 1j (511-1087) se ubican en un grupo intermedio teniendo un periodo de liberación de 12 hrs. cada una. Por ultimo, en términos de velocidad de producción de virus infeccioso tanto en la cinética de un paso (105 y 1171 DIC50/mL/hora para 113 y 1025 respectivamente vs 4762 y 175682 DIC50/mL/hora para 511 y 1025 respectivamente, en la cinética de un paso) como de múltiples pasos (1749 y 6635 DIC50/mL/hora para 113 y 1025 respectivamente vs 55423 y 131449 DIC50/mL/hora para 511 y 1025 respectivamente, en la cinética de múltiples pasos), las cepas 1j tienen mayor producción de virus infeccioso por hora de infección en relación a las cepas 1b. En general, los virus se comportan muy similares dentro de cada subgrupo, lo que sugeriría que existe un fenotipo similar en los integrantes de cada subtipo y este podría estar determinado por una característica genética específica conservada dentro de los subgrupos. Esto demuestra que, los virus estudiados presentan importantes diferencias en su replicación, encontrándose las mayores diferencias entre los virus del subgrupo 1j (511 y 1087) y los virus del subgrupo 1b (113 y 1025). Los virus 1j se multiplican más rápidamente y generando una mayor cantidad de viriones que los virus 1b. Sin embargo, los virus 1b forman focos infecciosos de mayor tamaño, especialmente el virus 1025, que los virus 1j y presentaron pendientes mayores en el período analizado de la cinética de múltiples pasos. 2.- Identificar zonas genómicas de las regiones 5’ NCR, 3’ NCR, Erns, E2 y NS3 como posibles responsables de las características replicativas de la cepa CH511. Para el cumplimiento de este objetivo se realizó una comparación de las secuencias nucleotídicas y aminoacídicas de regiones genómicas de 5’NCR, 3’NCR, Erns, E2 y NS3 de las diez cepas autóctonas en relación a la cepa de laboratorio NADL, con el propósito de identificar probables marcadores moleculares en la cepa chilena CH511 que puedan ser responsables de la mayor eficiencia replicativa de este aislado, observada en un estudio anterior [181] y en el objetivo específico Nº 1. Para el análisis se realizó una amplificación de secuencias genómicas de 5’NCR, 3’NCR, Erns, E2 y NS3 de las diez cepas autóctonas por RT-PCR (Transcripción Reversa - Reacción en Cadena de la Polimerasa) y posterior secuenciación genética, para finalmente hacer el análisis filogenético y aminoacídico. 2.1.- Análisis de la región 5’ NCR Las 9 cepas seleccionadas para este estudio fueron elegidas de un grupo de 45 muestras de campo (ver en Anexo Tabla Nº 1). En los 9 aislados seleccionados se amplificó una zona de la región 5`NCR por RT-PCR usando los partidores 324/326 [80]. Al someter una alícuota de la reacción post-PCR a electroforesis en un gel de agarosa al 2% en TBE con posterior tinción con bromuro de etidio, en todos los aislados virales se obtuvo un fragmento de ADN de 288 pares de bases (amplicón), sin embargo la cantidad de ADN sintetizado varió entre los distintos aislados virales. En aquellos casos en que la concentración final de amplicón fue mayor de 10 ng/µL se pudo realizar secuenciación directa del fragmento de ADN. En aquellos aislados virales, en que la concentración del amplicón obtenido fue menor de 10 ng/µL fue necesario clonar el fragmento de ADN en el vector pGEM T-Easy, transformar bacterias E. coli con el plasmidio y luego de multiplicar las bacterias por 12-16 horas a 37° C, purificar el plasmidio y secuenciar el fragmento de ADN inserto en el plasmidio. Las secuencias nucleotídicas obtenidas se alinearon usando el programa Clustal W 2, junto con 58 aislados virales nacionales e internacionales pertenecientes a los subgrupos 1a, 1b, 1c, 1d, 1e, 1f, 1g, 1h, 1i, 1j, 1k y 2a. El análisis filogenético molecular de las secuencias nucleotídicas obtenidas se realizó a través del programa MEGA de análisis bioinformático. Los resultados obtenidos se presentan en el árbol filogenético de la Figura Nº 5. En primer lugar el análisis confirma la clasificación de los aislados virales en los subgrupos 1a (916 y 1091), 1b (113 y 1025), 1i (921 y 1068), 1j (511 y 1087) y 2a (470 y 809). En cuanto a los porcentajes de identidad nucleotídica entre los 9 aislados virales chilenos utilizados en este estudio, se pudo observar que los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 72 y 78% (ver en Anexo Tabla Nº 3). Los virus pertenecientes al genotipo VDVB-1 presentan un PIN entre 89-100% y dentro de los aislados virales pertenecientes al genotipo VDVB-2 un 100%. Los PIN dentro del subgrupo VDVB-1a fue de un 94%, para el VDVB-1b fue de un 96%, para el VDVB-1j fue de un 99% y para el subgrupo VDVB-1i fue de un 100%. Los virus de los subgrupos VDVB1a y 1b son los que presentan entre ellos una mayor diversidad genética para esta región genómica. En cuanto a los porcentajes de identidad nucleotídica (PIN) entre los 10 aislados virales chilenos utilizados en este estudio, se pudo observar que los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 72 y 78% (ver en Anexo Tabla Nº 3). Los virus pertenecientes al genotipo VDVB-1 presentan un PIN entre 89-100% y dentro de los aislados virales pertenecientes al genotipo VDVB-2 un 100%. Los PIN dentro del subgrupo VDVB-1a fue de un 94%, para el VDVB-1b fue de un 96%, para el VDVB-1j fue de un 99% y para el subgrupo VDVB-1i fue de un 100%. Esto indica que los virus de los subgrupos VDVB 1a y 1b son los que presentan entre ellos una mayor diversidad genética para esta región genómica. Entre los subgrupos predominantes encontrados en ganado bovino nacional, es decir entre los subgrupos VDVB-1b y VDVB-1j, los PIN van entre un 90-91%. Entre los subgrupos VDVB-1b y VDVB-1i van entre un 89-91% y entre los subgrupos VDVB-1j y VDVB-1i fue de un 91%. Finalmente, los PIN entre los aislados del subgrupo VDVB-1a y los otros subgrupos del genotipo VDVB-1, es decir VDVB-1b, VDVB-1j y VDVB-1i, fue de 90-93%, 92-93% y 93% respectivamente (Ver en Anexo Tabla Nº 3). Figura Nº 5. Arbol filogenético de los aislados chilenos y de referencia en base a la región 5’NCR del VDVB Analisis de la estructura secundaria de 5’ NCR de cepas 1b, 1j y cepa NADL de VDVB Para el análisis de la estructura secundaria de un segmento de la región 5’ NCR se utilizó el Programa Mfold®. Mediante esta herramienta se pudo analizar la más probable estructura secundaria de esta región, importante para la por poseer el IRES y para la replicación del genoma viral. En la Figura Nº 6 se observa la estructura secundaria completa de 5’ NCR de la cepa 511 y la cepa NADL. En general, se observa una conservación de los dominios que son descritos para esta región, es decir los dominios I(a y b), II y III e incluso no hay mayores diferencias en los “stem-loop” descritos para cada dominio, a excepción del “stem-loop” ubicado en el dominio III denominado IIIf (indicado con una flecha roja en la Figura Nº 6), que formaría una estructura de pseudoknot con la región terminal de 5’ NCR. La existencia de esta estructura se ha descrito que aumenta la eficiencia replicativa de los virus que la poseen y la podemos observar en 511 pero no en la cepa NADL, por lo que con respecto a este aspecto habría una estructura que aumentaría la eficiencia replicativa en 511 en relación a cepa NADL. Figura Nº 6. Estructura secundaria de la región completa de 5’ NCR de la cepa 511 y la cepa de referencia NADL de VDVB obtenida mediante el programa Mfold® Sin embargo, al analizar la estructura secundaria del dominio III (nt 141-373, según cepa de referencia NADL) de las cepas del subtipo 1b (113 y 1025) y 1j (1087), se observa que el dominio IIIf se encuentra en las cepas 113 y 1025 (indicado con una flecha roja en la Figura Nº 7) y no en la cepa 1087, lo que indicaría que las diferencias replicativas encontradas no podrían ser atribuidas a esta estructura, sobre todo debido a que la cepa 1087, al igual que la cepa NADL, es una de las más eficientes en términos replicativos (cinética de un paso). Además, analizando el dominio III en su totalidad observamos gran conservación del resto de los “stem-loop” descritos para esta región genómica en las cepas 1b y 1j, por lo que en conclusión no se observarían diferencias a nivel de estructura secundaria para 5’ NCR que pudieran explicar las diferencias replicativas observadas en las cinéticas de crecimiento. Figura Nº 7. Estructura secundaria del dominio III de 5’ NCR (entre nt 141-373) de las cepas 113, 1025 y 1087 de VDVB obtenidas mediante el programa Mfold® 2.2.- Análisis de la región 3’ NCR Al igual que en la región 5’ NCR se realizó el análisis genético y de estructura secundaria de una zona de la región 3’ NCR para las 10 cepas en estudio. En general, se observa una gran variabilidad en la región 3’NCR de las distintas cepas incluso presentando longitudes variables entre 129 nt hasta 177 nt, con cierto grado de similitud en el tamaño en algunos subtipos, como por ejemplo las cepas 1b que presentan 136 y 138 nt para la cepa 113 y 1025 respectivamente, las cepas 1i (921 y 1068) que presentan 177 nt en la región secuenciada y las cepas 1j (511 y 1087) con 174 nt (ver en Anexo Figura Nº 6). No se observan regiones conservadas a excepción de los 22 nt terminales de la región secuenciada con 19 nt conservados para este segmento (ver en Anexo Figura Nº 6). Cuando se realizó el alineamiento de las cepas autóctonas incluidas en el estudio y las cepas de referencia se observó el mismo patrón de conservación (ver en Anexo Figura Nº 7) en el mismo sector genético, lo que evidencia que este segmento podría ser importante en la replicación del VDVB. Los resultados obtenidos de la comparación de las cepas autóctonas y las cepas de referencia se presentan en el árbol filogenético (ver en Anexo Figura Nº 5), que nos muestra que las cepas del subtipo 1a y 1i segregan en el mismo grupo genético y el resto de las cepas segregan con la cepa correspondiente a su mismo subtipo, a excepción de 470 que segregó con las cepas 1b, lo que hace sospechar una contaminación Analizando los porcentajes de identidad nucleotídica entre los 9 aislados virales chilenos utilizados en este estudio se observa una mayor variabilidad en la zona 3’NCR que la región 5’ NCR. Los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 56 y 73% (ver en Anexo Tabla Nº 4). Los virus pertenecientes al genotipo VDVB-1 presentan un PIN entre 73-100%. Los PIN dentro del subgrupo VDVB-1a fue de un 88%, para el VDVB-1b fue de un 97%, para el VDVB-1j fue de un 99% y para el subgrupo VDVB-1i fue de un 100%. Esto indica que los virus del subgrupo VDVB 1a es el que presenta una mayor diversidad genética para esta región genómica. Entre los subgrupos predominantes encontrados en ganado bovino nacional, es decir entre los subgrupos VDVB-1b y VDVB-1j, los PIN van entre un 82-83%. Entre los subgrupos VDVB-1b y VDVB-1i van entre un 83-84% y entre los subgrupos VDVB-1j y VDVB-1i fue entre un 81-82%. Finalmente, los PIN entre los aislados del subgrupo VDVB-1a y los otros subgrupos del genotipo VDVB-1, es decir VDVB-1b, VDVB-1j y VDVB-1i, fue de 73-84%, 90-98% y 79-82% respectivamente (Ver en Anexo Tabla Nº 4). Pese a la gran variabilidad nucleotídica, expresada por las diferentes longitudes y los PIN de cada una de las cepas pertenecientes a cada subtipo, observada en la zona analizada de la región 3’ NCR para las cepas de este estudio, la estructura secundaria se mantiene prácticamente inalterable con 3 “stem loop” bien definidos, como lo evidencia la Figura Nº 8 en la que se compara la estructura secundaria de la región 3’ NCR secuenciada de las cepas nacionales de los subtipos 1b y 1j de VDVB, que probablemente sean las cepas más prevalentes del ganado bovino nacional. Esta conservación de la estructura secundaria se mantiene en las demás cepas pertenecientes a los distintos subtipos de los aislados nacionales de VDVB analizados en este estudio, a excepción de la cepa 809 que presenta dos “stem loop” para la zona secuenciada (ver en Anexo Figura Nº 8). Figura Nº 8. Estructura secundaria de la cepa 511, 1087, 113 y 1025 de la zona secuenciada de la región 5’ NCR de VDVB obtenida mediante el programa Mfold® 2.3- Análisis de la región genómica de Erns En relación a 5’ NCR y 3’ NCR, la región genómica que codifica para la proteína Erns presenta una mayor conservación nucleotídica en las 10 cepas utilizadas en este estudio. La región de Erns secuenciada fue de 651 nt para la mayoría de las cepas, exceptuando las cepas 113 y 511 en que se secuenció 637 nt, esto corresponde a la secuencia casi completa de la región codificante para la proteína Erns (681 nt en la cepa de referencia NADL) (Ver en Anexo Figura Nº 9) y esencialmente comprende la totalidad de los sitios funcionales, ya que esta proteína además de ser estructural presenta actividad RNAsa. En cuanto al árbol filogenético (ver en Anexo Figura Nº 10), al igual que en análisis de la región 3’ NCR, la cepas 1a segregan junto a las cepas del subtipo 1i y en general las cepas se ubican junto a las cepas que corresponden a su subtipo genético, a excepción de la cepa 470 que segrega junto a las cepas del subtipo 1b, al igual que en la región 3’ NCR, lo que nuevamente hace sospechar de una contaminación.. Analizando los porcentajes de identidad nucleotídica entre los 9 aislados virales chilenos utilizados en este estudio se observa una mayor conservación en la zona secuenciada de la región Erns que la región 5’ NCR y 3’ NCR. Los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 72 y 74% (Ver en anexo Tabla Nº 5). Los virus pertenecientes al genotipo VDVB-1 presentan un PIN entre 81-99%. Los PIN dentro del subgrupo VDVB-1a fue de un 90%, para el VDVB-1b fue de un 95%, para el VDVB-1j fue de un 99% y para el subgrupo VDVB-1i fue de un 99%. Esto indica que los virus del genotipo 1 presentan una alta conservación dentro de cada subtipo, siendo nuevamente el subgrupo de VDVB 1a el que presenta una mayor diversidad genética para esta región genómica. Entre los subgrupos predominantes encontrados en ganado bovino nacional, es decir entre los subgrupos VDVB-1b y VDVB-1j, los PIN fue un 81%, lo mismo que entre los subgrupos VDVB-1b y VDVB-1i y entre los subgrupos VDVB-1j y VDVB-1i fue de un 84%. Finalmente, los PIN entre los aislados del subgrupo VDVB-1a y los otros subgrupos del genotipo VDVB-1, es decir VDVB-1b, VDVB-1j y VDVB-1i, fue de 81-82%, 89-99% y 82-84% respectivamente (Ver en Anexo Tabla Nº 5). Es notable indicar que al igual que lo observado en la región 3’ NCR, el mayor porcentaje de conservación nucleotídica en las cepas de genotipo 1 de VDVB para las cepas analizadas en este estudio, se observa entre los subtipos1a y 1i (90-98% en 3’ NCR y 89-99% para Erns). Para la región genómica secuenciada que codifica para la proteína Erns (se compararon los primeros 212 aminoácidos codificados por los primeros 636 nt desde el extremo 5’ hacia 3’ de un total de 227 que posee esta proteína) en las cepas autóctonas de VDVB se observa en el análisis aminoacídico que, en general, existe una mayor variabilidad de las cepas genotipo 1 vs la cepa 809 del genotipo 2, que dentro de las cepas del genotipo 1 de VDVB (Figura Nº 9). Sin embargo, más que la variabilidad aminoacídica entre cepas, lo más notable se obtiene analizando los sitios funcionales que le dan a la proteína Erns la actividad RNAsa. Los sitios activos de la proteína se ubican en los aminoácidos situados en posición 30, 74 y 79 (enmarcados en color rojo en la Figura Nº 9) [188-190]; y que corresponden a tres histidinas (H) que, en general, se encuentran muy conservadas en las cepas analizadas en este estudio, ya que cualquier mutación supondría una pérdida de la actividad RNAsa de la proteína. Sin embargo, en las cepas 511 y 1087 se observa una mutación en la posición 79 (Y por H enmarcado en color verde en la Figura Nº 9) y que para este estudio, por las cepas analizadas, se encontraría conservada para el subtipo genético. Otro sitio estructural muy importante es la cisteína (C) que se ubica en posición 171, que permite la homodimerización de la proteína Erns y se ha descrito como esencial para la funcionalidad de ésta [191]. Como se puede observar en la Figura Nº 9, todas las cepas analizadas en este estudio presentan C en la posición 171, según la secuencia nucleotídica obtenida para cada una de las cepas estudiadas. Por lo tanto, en este aspecto habría una estructura conservada que mantendría la funcionalidad de la proteína en todas las cepas incluidas en el estudio. En conclusión, las variaciones observadas en este segmento genómico se han generado por mutaciones o acumulaciones de estas y no por recombinaciones moleculares. Figura Nº 9. Análisis aminoacídico del segmento genómico codificante de la proteína Erns de las cepas autóctona de VDVB 2.4.- Análisis de la región genómica de NS3 En el caso del análisis de la región genómica que codifica para la proteína NS3, observamos que a diferencia de la proteína Erns que posee cierto grado de conservación nucleotídica y aminoacídica, la región codificante de la proteína NS3 tiene una mayor conservación aminoacídica que nucleotídica. La proteína NS3 posee 2049 nt (683 aa), según la cepa de referencia NADL. En este estudio analizamos la secuencia nucleotídica y aminoacídica de una porción hacia el extremo 5’ de la región genómica de NS3, alrededor de 651 nt, que codifican un segmento de la porción N-terminal de la proteína (ver en Anexo Figura 11), esta porción es la que presenta la actividad enzimática de serina-proteasa y helicasa/NTPasa que posee NS3. Además, analizamos la secuencia nucleotídica y aminoacídica de la porción C-terminal de la proteína, que presenta la función de unirse a membranas fosfolipídicas cuando se forma el complejo replicativo viral, para facilitar la actividad enzimática de la proteína (Figura Nº 11). Los resultados obtenidos de la comparación de las cepas autóctonas y las cepas de referencia para la región nucleotídica que codifica para la porción N-terminal de NS3 se presentan en el árbol filogenético (ver en Anexo Figura Nº 12), que nos muestra que las cepas del subtipo 1a y 1i segregan en el mismo grupo genético y nuevamente la cepa 470 segregó con las cepas del subtipo 1b. Al observar el alineamiento de la región nucleotídica hacia la porción N-terminal de NS3 (ver Anexo Figura Nº 11) se observa, en general, una alta conservación nucleotídica, lo que se refrenda en el análisis de los PIN. Esto indicaría que la zona funcional de la proteína NS3 tiene gran importancia en la replicación viral ya que varía poco genéticamente. Analizando los porcentajes de identidad nucleotídica entre los 9 aislados virales chilenos utilizados en este estudio se observa la mayor conservación con respecto a todas las zonas genómicas analizadas, hasta ahora, Erns, 5’NCR y 3’NCR (en orden de menor a mayor variabilidad genética). Los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 82 y 99% (ver en Anexo Tabla Nº 6). Los virus pertenecientes al genotipo VDVB-1 presentan un PIN entre 82-99%. Los PIN dentro del subgrupo VDVB-1a fue de un 91%, para el VDVB-1b fue de un 96%, para el VDVB-1j fue de un 99% y para el subgrupo VDVB-1i fue de un 99%. Nuevamente, esto indica que los virus del subgrupo VDVB 1a es el que presenta una mayor diversidad genética para esta región genómica. Entre los subgrupos predominantes encontrados en ganado bovino nacional, es decir entre los subgrupos VDVB-1b y VDVB-1j, los PIN van entre un 86-89%. Entre los subgrupos VDVB-1b y VDVB-1i fue entre 82-83% y entre los subgrupos VDVB-1j y VDVB-1i fue entre un 88-89%. Finalmente, los PIN entre los aislados del subgrupo VDVB-1a y los otros subgrupos del genotipo VDVB-1, es decir VDVB-1b, VDVB-1j y VDVB-1i, fue de 83-84%, 86-89% y 91-100% respectivamente (Ver en Anexo Tabla Nº 6). Al igual que con 3’ NCR y la región codificante de Erns la mayor similaridad entre subtipos se produce entre 1a y 1i, siendo el extremo contrario la baja similitud entre 1i con 2a y 1b respectivamente. En conclusión, de las zonas secuenciadas hasta el momento la región nucleotídica que codifica para la porción N-terminal de NS3, que además es la porción funcional de la proteína, se presenta como la más conservada genéticamente. Para la región genómica secuenciada que codifica para la proteína NS3, se compararon los aminoácidos codificados entre la posición 169 y 386 hacia el extremo N-terminal de la proteína de las cepas autóctonas de VDVB. Se observa en el análisis aminoacídico que, en general, a pesar de tener cierta variabilidad nucleotídica este segmento (ver Anexo Figura Nº 11) presenta una gran conservación en la secuencia aminoacídica del segmento, sólo se observa 7 aminoácidos mutados en 1 o mas cepas (un 3% de variación aminoacídica), lo que significaría que la gran mayoría de las mutaciones que se producen en este sector son silentes (Figura Nº 10). Al analizar los sitios funcionales de la región genómica secuenciada, observamos que hay una conservación total en todas las cepas para los aminoácidos que componen el bolsillo de unión y el sitio activo para la función de NS3 como serina-proteasa[58], en los sitios 189, 190, 213, 216 y 228 se sitúan los aminoácidos K, N, V, G y S respectivamente (enmarcados en color verde en la Figura Nº 10); aunque se produce una cambio con respecto a la serina-proteasa del VPPC en la posición 228 que posee I y en VDVB se observa S, sin embargo esta mutación entre dos especies de pestivirus se conserva en todas las cepas de VDVB analizadas en este estudio. Además la S ubicada en la posición 195 y que es el sitio activo que cumple la función de serina-proteasa, se conserva en todas las cepas autóctonas comparadas. Al comparar los sitios descritos para la función helicasa/NTPasa, encontramos que los motivos descritos bibliográficamente que presentan estas actividades como KGWSGLP, GRVVGR, VLIPLRAA, VAMTATPA, TGAGKT, y DEYH (enmarcados en color rojo, [67, 68] y azul, [192], en la Figura Nº 10), se encuentran en todas las secuencias de las cepas autóctonas analizadas y lo más importante no existen mutaciones en los sitios funcionales, lo que evidenciaría una conservación extrema, revelando un rol primordial en la replicación viral de las cepas analizadas. En conclusión, la región analizada de la proteína NS3 presenta una gran conservación nucleotídica y una, aun mayor, conservación aminoacídica en los sitios funcionales, incluidos en la región secuenciada para todas las cepas autóctonas de VDVB analizadas, lo que revela el rol esencial de esta proteína en el ciclo replicativo viral. Figura Nº 10. Análisis aminoacídico del segmento genómico codificante de la proteína NS3 (entre aa 169-386) de las cepas autóctonas de VDVB Además se analizó la porción C-terminal de la proteína NS3, una región que corresponde a los últimos 109 aa (327 nt) codificados de la proteína (entre los aa 574-682 inclusive), que presentó un perfil nucleotídico y aminoacídico muy similar a la región cercana al extremo N-terminal de NS3 analizada anteriormente. Los PIN obtenidos de los 9 aislados virales chilenos utilizados en este estudio (nuevamente se descartó la cepa 470 del análisis) se muestran en anexo en la Tabla Nº 7. Aunque la conservación nucleotídica se mantiene, es en un porcentaje menor que en la región próxima al extremo N-terminal de NS3. Por ejemplo, los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 80 y 100 (ver en Anexo Tabla Nº 7). Los virus pertenecientes al genotipo VDVB-1 presentan un PIN entre 80 y 99%. Los PIN dentro del subgrupo VDVB-1a fue de un 91%, para el VDVB-1b fue de un 97%, para el VDVB-1j fue de un 99% y para el subgrupo VDVB-1i fue de un 99%. Nuevamente, esto indica que los virus del subgrupo VDVB 1a es el que presenta una mayor diversidad genética para esta región genómica. Entre los subgrupos predominantes encontrados en ganado bovino nacional, es decir entre los subgrupos VDVB-1b y VDVB-1j, los PIN van entre un 81-82%. Entre los subgrupos VDVB-1b y VDVB-1i fue entre 80-81% y entre los subgrupos VDVB-1j y VDVB-1i fue de un 82%. Finalmente, los PIN entre los aislados del subgrupo VDVB-1a y los otros subgrupos del genotipo VDVB-1, es decir VDVB-1b, VDVB-1j y VDVB-1i, fue de 80-82%, 82-83% y 90-99% respectivamente (Ver en Anexo Tabla Nº 7). Hubo mayores diferencias entre cepas del genotipo 1, con respecto a la región N-terminal de la proteína antes analizada. Además, al igual que con la región de 3’ NCR, la zona de Erns y la región N-terminal de NS3 secuenciadas la mayor similaridad entre subtipos se produce entre 1a y 1i, siendo el extremo contrario la baja similitud entre 1i con 2a y 1b respectivamente. Para la región genómica secuenciada que codifica para la región C-terminal de la proteína NS3, se compararon los aminoácidos codificados entre la posición 574 y 682 de la proteína de las cepas autóctonas de VDVB. Se observa en el análisis aminoacídico que, en general, a pesar de tener cierta variabilidad nucleotídica este segmento (ver Anexo Tabla Nº 7) también presenta una alta conservación en la secuencia aminoacídica del segmento, sólo se observa 5 aminoácidos mutados en 1 o más cepas (un 4,5% de variación aminoacídica), lo que significaría que la gran mayoría de las mutaciones que se producen en este sector al igual que en la primera región secuenciada de NS3 son silentes (Figura Nº 11). Otro aspecto importante es que presenta una gran cantidad de aa apolares (50%), ver en Anexo Figura Nº 13, ya que esta región se une a membrana para facilitar la actividad enzimática de NS3 en el complejo replicativo viral [193]. Figura Nº 11. Análisis aminoacídico del segmento genómico codificante de la proteína NS3 (entre aa 169-387) de las cepas autóctonas de VDVB Otra región que se secuenció fue NS4A, una proteína de 54 aa y que se ha definido como un cofactor para la funcionalidad de serina-proteasa de NS3; además tendría una función en la formación de la partícula viral [193]. El alineamiento de la secuencia nucleotídica y comparación aminoacídica la podemos observar en la Figura Nº 14 (ver en Anexo), donde se observa que esta zona también presenta un alto grado de conservación genética y aminoacídica en las cepas analizadas, al igual que NS3, lo que podría deberse a las características funcionales de esta proteína. 2.5.- Análisis de la región genómica de E2 Al analizar la zona secuenciada de la región genómica que codifica para la proteína E2, observamos que a diferencia de la proteína Erns y NS3 que posee un alto grado de conservación nucleotídica y aminoacídica, la región codificante analizada de la proteína E2 tiene la mayor variabilidad nucleotídica y aminoacídica de las zonas codificantes comparadas. La proteína E2 posee 407 aa (1221 nt), según la secuencia de la cepa de referencia NADL. En este estudio analizamos la secuencia nucleotídica y aminoacídica de una porción hacia el extremo 5’ de la región genómica de E2, alrededor de 420 nt, que codifican un segmento hacia la porción N-terminal de la proteína entre aa 140 y 279 (ver en Anexo Figura 15). Los resultados obtenidos de la comparación de las cepas autóctonas y las cepas de referencia para la región nucleotídica que codifica para la región de E2 secuenciada se presentan en el árbol filogenético (Figura Nº 12), que nos muestra que las cepas del subtipo 1a y 1i, nuevamente segregan en el mismo grupo genético, el resto de las cepas tienen una ubicación filogenética esperada. Al observar el alineamiento de la región nucleotídica de E2 (ver Anexo Figura Nº 15) se observa, en general, una alta variabilidad nucleotídica, lo que se refrenda en el análisis de los PIN. Esto indicaría que la proteína E2 posee una gran variabilidad nucleotídica y probablemente aminoacídica, porque es una de las proteínas más inmunogénicas del virus [58], que posee una presión de selección, que promueve la variabilidad genética y aminoacídica. Además esta proteína es utilizada como receptor para la infección celular [134]. Analizando los porcentajes de identidad nucleotídica entre los 9 aislados virales chilenos utilizados en este estudio se observa la mayor variabilidad encontrada de las regiones codificantes analizadas. Los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 63 y 67% (ver en Anexo Tabla Nº 8). Los virus pertenecientes al genotipo VDVB-1 presentan un PIN entre 74-99%. Los PIN dentro del subgrupo VDVB-1a fue de un 86%, para el VDVB-1b fue de un 94%, para el VDVB-1j fue de un 98% y para el subgrupo VDVB-1i fue de un 99%. Nuevamente, esto indica que los virus del subgrupo VDVB 1a es el que presenta una mayor variabilidad genética de las cepas analizadas para esta región genómica. Entre los subgrupos predominantes encontrados en ganado bovino nacional, es decir entre los subgrupos VDVB-1b y VDVB-1j, los PIN van entre un 74-76%. Entre los subgrupos VDVB-1b y VDVB-1i fue entre 74-76% y entre los subgrupos VDVB-1j y VDVB-1i fue entre un 75-77%. Finalmente, los PIN entre los aislados del subgrupo VDVB-1a y los otros subgrupos del genotipo VDVB-1, es decir VDVB-1b, VDVB-1j y VDVB-1i, fue de 74-76%, 75-76% y 86-99% respectivamente (Ver en Anexo Tabla Nº 8). Al igual que con 3’ NCR, la región codificante de Erns y la regiones analizadas de NS3, la mayor similaridad entre subtipos se produce entre 1a y 1i, lo que se ve refrendado por la segregación en conjunto que se produce en el árbol filogenético obtenido para esta región con las cepas nacionales en estudio y las cepas de referencia. Figura Nº 12. Arbol filogenético de los aislados chilenos y de referencia en base a la región secuenciada de E2 del VDVB Para la región genómica secuenciada que codifica para la proteína E2, se compararon los aminoácidos codificados entre la posición 140 y 279 de la proteína de las cepas autóctonas de VDVB (Figura Nº 13). Se observa en el análisis aminoacídico que existe, como era esperable, una gran variabilidad en la secuencia aminoacídica, siendo observados sólo pequeños segmentos de conservación aminoacídica, LGGNWTC, CKWCG, YPIGKCR, GVAIVP y KLGPMPC (enmarcados en azul en la Figura Nº 13), que podrían tener importancia en la composición estructural de la proteína. Esto además, confirma la gran variabilidad de esta proteína debido a que es la proteína más inmunogénica de VDVB. Figura Nº 13. Análisis aminoacídico del segmento genómico codificante de la proteína NS3 (entre aa 140-279) de las cepas autocotona de VDVB En conclusión, de las zonas secuenciadas codificantes, la región de E2 se observa como la más variable para las cepas nacionales analizadas de VDVB. 2.6.- Determinación de actividad ribonucleasa en aislados chilenos pertenecientes a los subgrupos 1b y 1j del virus diarrea viral bovina Debido a que la diferencia genética, expresada como variación aminoacídica, más importante observada en el análisis de los aislados nacionales fue la mutación en el sitio activo de Erns en el codón ubicado en posición 79 en la proteína. Se realizó un ensayo en células MDBK (ver protocolo en Anexo) para determinar si esta variación genética y aminoacídica, se expresaba en una actividad funcional alterada de las cepas poseedoras de la mutación (511 y 1087 del subtipo 1j): Evaluando la actividad RNAsa en cultivos celulares infectados con las cepas 1b y 1j (ver Títulos obtenidos en Anexo Figura Nº 16), usando como control de actividad enzimática la cepa de referencia NADL. Como resultado, se evidencia una eliminación total de la actividad RNAsa en las cepas 1j expresando el mismo nivel de actividad que los cultivos sin infectar, mientras las cepas 1b (113 y 1025) y la cepa NADL (1a) expresan niveles similares de actividad (entre 0,6 a 0,8) (Figura Nº 14). Esto refleja que la funcionalidad de la proteína estaría alterada en las cepas 1j analizadas debido al cambio aminoacídico. Figura Nº 14. Evaluación de la actividad RNAsa de cepas 1b, 1j y la cepa de referencia NADL de VDVB en células MDBK infectadas con 0,01 DIC50 virus/cél. DISCUSION Objetivo Específico Nº1: 1.- Determinar la eficiencia replicativa del aislado nacional CH511 (genotipo 1j) con respecto a virus del mismo y otros subtipos presentes en el país. Los virus nacionales caracterizados en esta Tesis por su eficiencia replicativa fueron seleccionados desde un grupo de 45 aislados nacionales, mantenidos en el laboratorio de Virología Animal de la Facultad de Ciencias Veterinarias y Pecuarias de la Universidad de Chile a -80°C. De los 45 aislados virales, 5 pertenecen al genotipo VDVB2 y 40 pertenecen al genotipo VDVB1, con 2 aislados al subgrupo VDVB1a, 15 al subgrupo VDVB1b, 20 al subgrupo VDVB1j y 3 al subgrupo VDVB1i (ver en Anexo Tabla Nº 1). Esto da cuenta de una alta variabilidad genómica entre los aislados virales que circulan en la masa bovina nacional, pero con una clara predominancia de los subtipos VDVB1b y VDVB1j. Es relevante la aparente asociación del subtipo 1j a cuadros reproductivos, ya que es la principal causa de pérdidas económicas producidas por el virus en la industria del bovino. De los 20 virus de este subtipo, 11 fueron aislados desde animales con este tipo de patología. El perfil genético de los virus nacionales es muy similar al reportado para los virus que circulan en Argentina [194]. En dicho país están presentes ambos genotipos del virus, pero con mucha mayor presencia del genotipo VDVB1. Dentro del genotipo 1, al igual que en Chile se han detectado los subgrupos 1a, 1b, 1i y 1j, pero con predominancia de los virus del subgrupo 1a y del subgrupo 1b. Para esta Tesis se seleccionaron 10 de estos 45 aislados virales nacionales, 2 virus de cada subtipo: VDVB1a, 1b, 1i, 1j y 2a, siendo una de ellas el aislado chileno CH511 del subtipo VDVB1j, aislado en 1993 desde un feto abortado y con antecedentes de poseer una alta eficiencia replicativa. A estos virus se debe añadir la cepa de referencia NADL (ATTC VR-1422) de VDVB que pertenece al genotipo 1a. Análisis del ciclo infectivo viral y eficiencia de síntesis de viriones en curvas de multiplicación de un paso y múltiples pasos. Existe nula investigación, en este ámbito, en la literatura científica internacional con respecto al VDVB, siendo el estudio de Mittelholzer et al., 2000; en aislados de baja y alta virulencia del virus Peste Porcina Clásica, perteneciente al mismo género Pestivirus, uno de los pocos trabajos en el área. Este investigador demostró que la producción de progenie extracelular se correlacionaba con la virulencia de las cepas, a diferencia de la producción de genoma viral y progenie intracelular, las cuales no mostraron diferencias significativas entre cepas de distinta virulencia[111]. 1) Duración del ciclo infectivo viral. Se definió como el período de tiempo en horas, transcurrido desde el inicio de la infección hasta la estabilización en el aumento de la progenie viral. En la duración del ciclo infectivo en la curva de multiplicación de un paso, observamos una gran variabilidad en los tiempos necesarios para completar el ciclo de infección (entre 15 y 33 horas), ubicando a las cepas 1j en el grupo de los ciclos más cortos (21 y 18 horas para las cepas 511 y 1087, respectivamente) y las cepas 1b en el grupo de los ciclos más largos (30 y 27 horas para las cepas 113 y 1025, respectivamente). Estos resultados son coincidentes con lo obtenido por Montt (2004) aunque el tiempo obtenido para la cepa 1j (511) fue aún menor (9 horas) y se necesitó 24 horas para que la cepa 113 completara su ciclo infectivo. Dentro de los tiempos obtenidos cabe destacar a las cepas 1a y 1i, que presentan una gran similaridad genética (según el análisis genómico posterior de las distintas regiones analizadas), ya que fueron los que presentaron una replicación mas eficiente desde este punto de vista con 15 horas para las cepas 916 y 921; y 18 horas para las cepas 1091 y 1068 (Tabla Nº 6). Gong et al., 1996 para un virus subtipo 1c (caracterizado posteriormente por Becher et al., 1998, Nº acceso Genbank AF049223 [19]) obtuvo una duración del ciclo infectivo de 16 horas [151] y en el caso de Mittelholzer et al., 2000 encontró en cepas de VPPC de distinta virulencia, ciclos infectivos que duraron entre 24 a 30 horas [111]. Los resultados de Mittelholzer et al., 2000, son similares con los obtenidos por Quetalpillán (2012) que realizó una caracterización biológica de cepas obtenidas de camélidos sudamericanos 1a, 1e (homóloga a 1j de bovinos) y 2a, con tiempos de duración del ciclo infectivo para cepas 1a de 33,75 horas y 34,125 horas para cepas 1e, encontrando diferencias signficativas con cepas 2a que demoraron 30,5 horas en completar su ciclo infectivo [195]. Convengamos que se ha observado que la más probable procedencia de cepas obtenidas de camélidos sudamericanos [113], en nuestro país, es bovina [196]; por lo que la comparación de los resultados encontrados en estudios de cinéticas de replicación para estas cepas es totalmente atingente. Las diferencias observadas en los tiempos que requiere cada subtipo para completar la multiplicación viral, en la curva de multiplicación de un paso, se hace más notable en la replicación de múltiples pasos, obteniendo en este parámetro las cepas 1j la mayor diferencia con respecto a las demás cepas, ya que completa la multiplicación viral a las 36 horas la cepa 511 y 48 horas la cepa 1087. El resto de las cepas completan la multiplicación viral en la curva de múltiples pasos a las 60 horas (cepas 916, 1091, 1025 y 921) y 72 horas (cepas 113, 1068 y 809) (Tabla Nº 6). Según Mittelholzer et al. (2000), la distinta duración de los ciclos infectivos virales, se debería a propiedades intrínsecas de los virus, la cantidad usada de virus infecciosos parentales en la infección viral, la susceptibilidad de las células para ser infectadas y la permisividad de ellas para multiplicar a los virus[111]. En el caso de nuestro estudio, la única variable distinta entre las curvas de multiplicación de un paso y múltiples pasos, está dada por la cantidad de virus infeccioso usada para infectar el cultivo de células MDBK (1 DIC50 virus/célula para curva de un paso y 0.05 DIC50 virus/célula para curva de múltiples pasos). Las diferencias observadas en la duración de los ciclos infectivos virales de los distintos subtipos, podrían explicarse por la existencia de dos distintos mecanismos de diseminación de la progenie viral del VDVB. Al respecto, se sabe que la progenie del VDVB puede salir de la célula infectada, generando viriones libres e infectar células a distancia (diseminación extracelular); o bien permanecer asociada a la célula, infectando a las células vecinas a través de la membrana de la célula, generando focos de células infectadas (diseminación célula a célula) [64, 136]. Según postula Montt, 2004, en el VDVB, los ciclos infectivos cortos serían un tipo de factor de virulencia, ya que al generar una alta cantidad de progenie viral en poco tiempo, como lo observado en las cepas 1j, esto le permitirá al virus competir de mejor manera con el sistema inmune del animal, permitiendo una diseminación más rápida de la infección viral en el individuo infectado, probablemente provocando una infección sistémica, con alta viremia, similar a lo realizado por virus herpes equino al provocar abortos (estrategia de infección por número). En cambio, en los virus que poseen ciclos infectivos largos, como lo observado especialmente en los virus del subtipo 1b, serían menos virulentos o bien, virus que tendrían un mecanismo distinto de diseminación de la infección viral, en que la progenie viral realizaría una infección célula a célula más eficiente, lo que la protegería de la acción del sistema inmune del animal y facilitaría la infección de los epitelios celulares (estrategia de infección por protección de la progenie[181].). 2) Rendimiento viral: En cuanto a los títulos máximos obtenidos en la curva de multiplicación de un paso, las cepas 1j nuevamente se ubican en el grupo de mayor rendimiento con las cepas 1a, con una producción de 5.0 DIC50/mL para las cepas 511 y NADL; 6.0 DIC50/mL para la cepa 1091 y 6.5 DIC50/mL para la cepa 1087. Mientras las cepas 1b se ubican en el grupo de menor producción con título individuales de 3.5 DIC50/mL para la cepa 113 y 4.5 DIC50/mL para la cepa 1025 (el rango de este grupo osciló entre 3 y 4.5 DIC50/mL) (Tabla Nº 7). Estos resultados ubican a las cepas 1j en un grupo de mayor eficiencia, con respecto a este parámetro, en relación al subtipo 1b. En este aspecto, el estudio realizado por Quetalpillán (2012) en virus de alpacas y llamas, obtiene resultados similares a los del presente trabajo con valores promedios de 4,2 DIC50/mL para el genotipo 1b, 6,1 DIC50/mL para el genotipo 1e y 4,6 DIC50/mL para el genotipo 2a, encontrando que las diferencias en títulos obtenidas entre las cepas 1e con la 2a y 1b son significativas y que los títulos entre las cepas 2a y 1b son similares [195]. Sin embargo, en el estudio de Montt (2004) los títulos máximos para las cepas 511, NADL y 113 fue de 5.8 logDIC50/mL; y para las cepas 809 y 470 fue de 4.8 logDIC50/mL, obtenido a las 30 horas post-infección. Según Montt, esto sugiere que la cantidad de virus sintetizado por ciclo infectivo no parece ser un factor de virulencia importante entre cepas del genotipo 1, pero si al comparar cepas del genotipo 1 y 2 [181]. Mittelholzer et al., (2000), detectó que las diferencias en esta variable para los VPPC de mayor y menor virulencia fueron de poco más de 2 log10 [111]. El resultado de la duración del ciclo infectivo y los títulos máximos virales alcanzados, serían una expresión de una replicación más eficiente, por lo menos para el análisis de la curva de replicación de un paso, de las cepas 1j en relación a las cepas 1b. 3) Eficiencia de síntesis de virus infecciosos. Al analizar la eficiencia de síntesis de viriones en la curva de multiplicación de múltiples pasos (Tabla Nº 14), los resultados, en todos los tiempos de comparación, son mayores en las cepas 1j en relación a las cepas 1b. Así, a las 12 horas de infección las cepas 113 y 1025, no tienen niveles detectables de virus infeccioso; y las cepas 1j tienen 3,5 y 3,8 logDIC50/mL para 511 y 1087 respectivamente, manteniendo la tendencia a las 24 horas (3 y 2,4 logDIC50/mL para 113 y 1025, respectivamente vs 4,9 y 5,6 logDIC50/mL para 511 y 1087, respectivamente), 36 horas (3,5 y 3,8 logDIC50/mL para 113 y 1025, respectivamente vs 6,1 logDIC50/mL para 511 y 1087) y al término de la multiplicación viral (5,1 y 5,6 logDIC50/mL para 113 y 1025, respectivamente vs 6,3 y 6,8 logDIC50/mL para 511 y 1087, respectivamente). Lo que demuestra que, en este aspecto, se observó una tendencia muy similar a la curva de multiplicación de un paso. Aunque es importante señalar que se observa un evidente aumento en la eficiencia replicativa de las cepas 1b entre las 36 horas y el tiempo de medición final de multiplicación viral, con un aumento de 1,6 log10 y 1,8 log10 para las cepas 113 y 1025, respectivamente vs 0,2 log10 y 0,7 log10 para las cepas 511 y 1087, lo que significa que desde las 36 horas hubo un aumento notable de la velocidad replicativa de las cepas 1b en relación a las cepas 1j. Esto es corroborado por el posterior análisis de las pendientes de las curvas de multiplicación de múltiples pasos. 4) Período de eclipse viral. Al evaluar el periodo de eclipse, la mayoría de los virus requieren para formar nuevos viriones entre 6 y 9 horas (cepas NADL, 1091, 113, 1025, 511 y 1087) y en el segundo grupo se ubican los que requirieron mas tiempo, entre 12 y 15 horas (916, 921 y 1068). Una de las cepas analizadas fue extremadamente lenta en este aspecto y correspondió a la cepa 809 (Tabla Nº 8). Estos resultados son similares a los obtenidos por Quetalpillán (2012) que obtuvo un rango en el periodo de eclipse, para la mayoría de los aislados, entre 9 y 12 horas. Con la salvedad que, cepas del genotipo 1b (A474 con 24 horas y A390 con 18 horas) y 2a (LL794 con 21 horas) requirieron tiempos mayores para esta etapa [195]. Debido a esto, se pudo establecer diferencias significativas entre los genotipos 1e y 1b, y entre los genotipos 1e y 2a, no estableciéndose diferencias significativas entre los genotipos 1b y 2a. Para este índice, Montt, (2004) ) obtuvo resultados similares a los observados por Quetalpillán (2012), aunque sólo analizó tres cepas, obteniendo tiempos de 3, 9 y 15 horas para aislados de genotipo 1j, 2a y 1b [181]. Con respecto a este parámetro Gong et al., (1996) para un aislado de VDVB tuvo un periodo de latencia de 10 horas [151] y Mittelholzer et al., (2000) para seis aislados de VPPC tuvo periodos de latencia que fluctuaron entre seis y 12 horas [111]. Según los resultados consultados bibliográficamente y los obtenidos en nuestro estudio, el período de eclipse se podría considerar variable, con un rango de tiempo que podría demorar, para la obtención del virus a nivel extracelular, desde 3 horas [181] hasta 24 horas como fue para el aislado 809 de nuestro estudio pero, en la mayoría de los casos, el rango es entre 9 y 12 horas, muy similar a lo obtenido en nuestro estudio. Según Mittelholzer et al., (2000), el tiempo que necesita el virus para liberarse de la célula podría estar asociado a la virulencia, ya que cepas de VPPC de alta virulencia tuvieron periodos de latencia de seis y nueve horas y en las cepas de mediana y baja virulencia los periodos de latencia fueron de nueve y 12 horas [111]. Por lo tanto en este aspecto no encontramos diferencias entre las cepas 1b (con 12 hrs para el periodo de eclipse) y las cepas 1j (con 12 hrs para la cepa 511 y 9 hrs para la cepa 1087), observando sólo a la cepa 1087 con una replicación más precoz. Distinto a lo observado por Quetalpillán (2012) que según este parámetro consideraría que los aislados de VDVB obtenidos de CSA del genotipo 1e (homólogo a 1j bovino) serían más virulentos debido a que los promedios de tiempo fueron más bajos que los de genotipos 1b y 2a [195]. 5.- Virus residual. Al analizar el título de virus residual en la cinética de multiplicación de un paso, índice que refleja el virus adsorbido pero que no penetra las células del cultivo celular. Las cepas 1b y 1j se ubican en el grupo que presentan títulos menores para este parámetro, entre 0 y 2,5 DIC50/mL (cepas 916, 113, 1025, 511, 1087 y 809). Los que presentan mayores títulos son cepas que pertenecen al subtipo 1a y 1i (1091, 921 y 19068), lo que indica que gran cantidad de virus fue adsorbido pero no penetró a las células y que puede existir una relación con respecto a este parámetro y al genotipo de VDVB. Para este parámetro, Quetalpillán (2012) obtuvo valores promedios de 2,0 DIC50/mL para el subgrupo 1b, 2,1 DIC50/mL para el subgrupo 1e y 1,5 DIC50/mL para el subgrupo 2a, encontrando diferencias significativas para el subgrupo 2a comparado con los subtipos 1e y 1b, en cambio, los subgrupos 1b y 1e, no presentaron diferencias significativas entre ellos [195]. Con respecto a este índice, Mittelholzer et al., (2000) señala que la infectividad de cepas de VPPC residuales no adsorbidos se mantuvieron completamente estables, en el medio de cultivo celular sobrenadante a 37º C por un periodo de al menos seis horas. Esta situación, según el autor, sería atribuible a la relativa mayor resistencia a la temperatura que presentan los pestivirus [111]. La variación en los títulos de virus residual podría deberse a una diferencia en la afinidad de los aislados por los receptores de la célula, ya que los procedimientos se realizaron en forma sincronizada, inoculando la misma cantidad de virus infeccioso, sobre una similar cantidad de células obtenidas de un mismo subcultivo celular. Además, en los procedimientos de inoculación de los aislados y de lavado de las monocapas celulares infectadas, se aplicó el mismo protocolo. Por lo que, al observar diferencias en estos parámetros están podrían explicarse por diferencias de estructura y/o conformación de las proteínas de envoltura (Erns, E1 y E2), principalmente de la proteína E2, que posteriormente fue analizada genética y aminoacídicamente. 6) Período de síntesis de virus infeccioso. En cuanto al período de liberación de viriones en la curva de multiplicación de un paso. Las cepas 1b (21 y 18 hrs para cepas 113 y 1025 respectivamente) se ubican en el grupo con el periodo más largo de liberación de viriones, lo que es concordante con su mayor duración del ciclo infectivo y las cepas 1j se ubican en un grupo intermedio (12 horas para cepas 511 y 1087). Estos resultados fueron mayores que lo obtenido por Montt (2004) que obtuvo periodos de liberación de VDVB, de 3 horas para el genotipo 2a y de 6 horas para el genotipo 1b y 1j, o sea que no encontró diferencias entre 1b y 1j [181]; y a los de Gong et al., (1996) que para el aislado viral bovino (1c) fue de 6 horas [151], por lo que en general en estos estudios se obtuvo períodos de liberación menores. Por otra parte, Quetalpillán (2012), que encontró diferencias entre las cepas 1e (homólogo a 1j), 2a y 1b, observó que los períodos de liberación fueron mayores en 1e en relación a 1b y 2a, o sea resultados contrarios a los nuestros [195]. Los resultados más cercanos fueron los obtenidos por Mittelholzer et al., (2000) con las cepas de VPPC en que los tiempos de liberación máxima de viriones fueron de 15 a 21 horas, siendo más prolongados en las cepas de baja virulencia (21 horas) [111], algo similar a lo observado por nosotros con las cepas 1b. La gran disparidad en la tendencia mostrada por este índice demuestra que no sería un buen indicador de la eficiencia replicativa como lo son, por ejemplo, la duración del ciclo infectivo o los títulos de virus infeccioso obtenidos tanto parcial como finalmente. 7) Velocidad de producción de virus infeccioso. En base al rendimiento de las cepas en cultivos celulares en la curva de multiplicación de un paso, las cepas 1b (105 y 1171 DIC50/mL/hora para 113 y 1025, respectivamente) tuvieron una menor productividad que las cepas 1j (4762 DIC50/mL/hora para la cepa 511 y 175682 DIC50/mL/hora para la cepa 1087) (Tabla Nº11). Este índice también se calculó para la curva de multiplicación de múltiples pasos y la tendencia se mantiene en relación a la curva de multiplicación de un paso, en cuanto a que las cepas 1b se ubican en el grupo de menor rendimiento (1749 y 6635 DIC50/mL/hora para las cepas 113 y 1025) y las cepas 1j en el de mayor productividad (55423 y 131449 DIC50/mL/hora para las cepas 511 y 1025) (Tabla Nº 12). Estos resultados son coincidentes con los obtenidos por Quetalpillán (2012) que encontró que las cepas 1e son las de mayor rendimiento con 36892 DIC50/hora, con 470 DIC50/hora para el genotipo 1b, el de menor rendimiento y 1305 DIC50/hora para genotipo 2a, valores con diferencias estadísticas significativas entre los tres genotipos [195]. Por lo que habría coincidencia en un parámetro importantísimo para evaluar la eficiencia replicativa, la cantidad de virus producido por unidad de tiempo. Un parámetro no analizado por otros trabajos de cinéticas replicativas de cepas de VDVB corresponde a las pendientes de las curvas de multiplicación en la fase de crecimiento exponencial, que sería un índice interesante para evaluar la velocidad de crecimiento de la cepa viral. Según los resultados que obtuvimos y comparando las cepas 1b y 1j, que son las más prevalentes en Chile, y presentan las mayores diferencias replicativas en términos de duración del ciclo infectivo, títulos de virus infeccioso y rendimiento de producción de viriones, observamos que las pendientes de las curvas de multiplicación de un paso presentaban diferencias significativas (Tabla Nº 13), siendo la cepa 113 la menos eficiente en este aspecto y las cepas 511, 1087 y 1025 no presentaban diferencias. Sorprendentemente, en la cinética de múltiples pasos, la tendencia se invierte totalmente observando que existen diferencias entre los subtipos 1b y 1j, no existiendo diferencias entre las cepas del mismo subtipo. Las cepas 1b en las cinéticas de múltiples pasos tendrían mayor eficiencia replicativa, al comparar las pendientes obtenidas de sus curvas de crecimiento en relación a las cepas 1j. Con respecto a este resultado, debemos nuevamente decir que los protocolos de inoculación utilizados fueron iguales sólo variando la dosis de virus utilizada en la infección de los cultivos celulares. Aunque es muy importante recalcar que este análisis se realizó entre las 12 y 36 horas y puede que haya sido determinado en un tiempo tardío para las cepas 1j que presentaron ciclos replicativos más precoces en la curva de multiplicación de múltiples pasos (36 y 48 para cepas 1j vs 60 y 72 hrs para cepas 1b), como también en la curva de multiplicación de un paso, por lo que probablemente la pendiente de las cepas 1j debería calcularse a tiempos menores, ya que es realmente en esta etapa cuando su crecimiento es verdaderamente exponencial. 8) Diseminación célula a célula de la infección viral. Para evaluar la diseminación célula-célula de la infección viral se inoculó monocapas de células MDBK cubiertas con un medio de cultivo semisólido, para eliminar la diseminación extracelular del virus. Al igual que lo obtenido en las pendientes de las curvas de múltiples pasos, las cepas 1b (0,34 mm para cepa 113 y 1,63 mm para cepa 1025) fueron más eficientes en este aspecto que las cepas 1j (0,26 mm para cepa 511 y 0,28 mm para cepa 1087), que se ubicaron en el grupo con diámetros de focos más pequeños. Con respecto a estos resultados, se puede concluir que hay diferencias significativas en la eficiencia de la diseminación célula a célula de la infección viral, entre virus del subtipo 1b y 1j, que apoyan lo comentado anteriormente acerca de las distintas estrategias de diseminación viral propuestas por Montt (2004) para los distintos subtipos del VDVB. En estos términos, los virus del subtipo 1b realizan más eficientemente la diseminación célula a célula vs los virus del subtipo 1j, que sin embargo son más eficientes en liberar su progenie al medio extracelular. Es posible que una estrategia de diseminación no sea más eficiente que la otra, sino que apuntarían a objetivos diferentes en la infección viral.[181]. Sobre este punto volveremos nuevamente en el análisis genómico realizado en nuestro estudio, para intentar exponer algunos factores que podrían favorecer alguna de las dos estrategias propuestas. En resumen en los resultados obtenidos para el objetivo específico Nº 1, en general encontramos que las cepas del subtipo 1j presentaron una mayor eficiencia replicativa en ciertos parámetros importantes con respecto a las cepas del subtipo 1b, como por ejemplo la duración del ciclo infectivo, los títulos de virus infeccioso, el rendimiento de producción de viriones y las pendientes en la fase de crecimiento exponencial (cepas 511 y 1087 vs 113) en la curva de multiplicación de un paso; además de la duración del ciclo de multiplicación viral, el rendimiento de producción de virus infeccioso y los títulos máximos de virus infecciosos en la curva de multiplicación de mútliples pasos. Esta diferencia denota en general una replicación más rápida que en general produjo mayor cantidad de virus infeccioso en las curvas de multiplicación. Esto se podría definir como una estrategia de replicación, como sería producir gran cantidad de viriones en menor tiempo. Sin embargo, hay que mencionar que la diferencia no se hizo tan manifiesta en la fase de crecimiento exponencial en la curva de multiplicación de múltiples pasos, en que las cepas 1b presentaron mayores pendientes que las cepas 1j, lo que reflejó un rendimiento más eficiente en esta fase de la multiplicación viral, algo que al parecer tendría que ver con los tiempos en los que se calcula la pendiente y la diferencia en la eficiencia de adsorción-penetración que pudieran tener los virus pertenecientes al subtipo 1b. Adicionalmente, las cepas del subtipo 1b presentan un mayor diámetro de los focos de las células infectadas, en el ensayo de diseminación célula a célula, lo que puede tener relación con lo observado en la curva de múltiples pasos, que refleja una estrategia de diseminación distinta y además estaría relacionado como, discutiremos posteriormente, con la capacidad de las cepas 1b de inhibir la respuesta inmune innata celular a través de la proteína Erns. Finalmente, podemos decir que los virus se comportan muy similares dentro de cada subtipo, lo que sugeriría que existe un fenotipo similar en los integrantes de cada subtipo y este podría estar determinado por características genómicas específicas conservadas dentro de los subgtipos virales. Objetivo específico Nº 2: Identificar zonas genómicas de las regiones 5’ NCR, 3’ NCR, Erns, E2 y NS3 como posibles responsables de las características replicativas de la cepa CH511. Para el cumplimiento de este objetivo se realizó una comparación de secuencias nucleotídicas y, en el caso que correspondió, aminoacídicas de regiones genómicas de 5’NCR, 3’NCR, Erns, E2 y NS3 de las diez cepas autóctonas junto a la cepa de referencia NADL, con el propósito de identificar probables marcadores moleculares en la cepa chilena CH511 que puedan ser responsables de los parámetros de mayor eficiencia replicativa de este aislado, observada en un estudio anterior [181] y en el objetivo específico Nº 1. Para el análisis se amplificaron secuencias genómicas de 5’NCR, 3’NCR, Erns, E2 y NS3 de las nueve cepas autóctonas por RT-PCR (Transcripción Reversa-Reacción en Cadena de la Polimerasa) y luego de obtener la secuencia nucleotídica se realizó el análisis filogenético y aminoacídico. El primer concepto relevante se refiere a la variedad de subtipos de VDVB (1a, 1b, 1i, 1j y 2a), según el análisis filogenético de la región 5’ NCR, que posee nuestro país, siendo los más frecuentes 1b y 1j (ver tabla en Anexo Nº 1), ya que el conocimiento de las cepas más prevalentes en una determinada región es fundamental para el establecimiento de programas de control y erradicación efectivos para cualquier enfermedad infecciosa. La aplicación de vacunas debiera considerar la inclusión de las cepas prevalentes en el país ya que existe evidencia que indica que antisueros contra un determinado subgrupo, pueden presentar baja reactividad cruzada contra aislados de sub-grupos diferentes. Es así como se reportan diferencias de al menos 4 veces en los títulos neutralizantes entre aislados VDVB-1a y VDVB -1b [18], 11,3 a 45 veces entre aislados VDVB -1c y VDVB -1a y 11,3 a 22,5 veces entre aislados VDVB -1c y VDVB -2 [33]. Ridpath et al., 2010 reporta, en un estudio realizado con cepas norteamericanas y australianas, una neutralización cruzada (expresada como porcentaje de la neutralización homóloga) de 2%, entre cepas sueros contra cepas 1a y 2a, 4% entre sueros anti-1b y 2a; y 36% entre sueros anti-1a y 1b [13]. Esto indica que la variabilidad antigénica del VDVB sumada al hecho de que la mayoría de las vacunas comercialmente disponibles para VDVB se producen en base a un par de aislados pertenecientes a los subgrupos VDVB-1a y en menor medida con cepas VDVB-1b y a un aislado VDVB-2a, permite pensar que la población bovina vacunada no estaría totalmente protegida frente a la infección con algunos subtipos de VDVB-1, sobre todos los no incluidos en las vacunas como el subtipo 1j, los que podrían seguir diseminándose en el país. El análisis de los resultados del análisis genómico se centró en la funcionalidad de las regiones analizadas, como por ejemplo la estructura secundaria de 5’NCR y 3’NCR o las secuencias aminoacídicas de Erns, NS3 y E2, ya que más importante, para nuestro análisis, que las diferencias genéticas encontradas en las regiones genómicas de VDVB es la variación funcional que pudieran producir las diferencias genómicas observadas. Análisis de la región 5’ NCR El análisis filogenético de los aislados virales permitió confirmar la tipificación de los aislados virales en los subtipos 1a (916 y 1091), 1b (113 y 1025), 1i (921 y 1068), 1j (511 y 1087) y 2a (470 y 809). En cuanto a los porcentajes de identidad nucleotídica entre los 9 aislados virales chilenos, se pudo observar que los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 72 y 78% (ver en Anexo Tabla Nº 3). Los virus pertenecientes al genotipo VDVB-1 presentan un PIN entre 89-100%. Jones et al., 2001 describe una alta variabilidad en la región 5’ NCR al punto de sugerir que en la infección con VDVB se producen cuasiespecies virales en el mismo individuo, lo que ayudaría a producir una infección persistente y evasión del sistema inmune [194]. La región 5’ NCR de pestivirus, como también la región 3’ NCR, poseen estructuras secundarias importantes para la replicación del genoma y la traducción de la poliproteína viral debido a que en esta región se encuentras el IRES [197]. El límite 5’ del IRES reside en el extremo 5' del stem-loop II, cerca del nucleótido 75. El 3'del IRES se extiende al extremo 5' del ORF de la poliproteína, porque la deleción de la región codificante de Npro (la primera proteína codificada por el genoma de VDVB) disminuye la traducción en un 21% [198]. Chon et al. (1998) establecieron a través de análisis de traducción in vivo para VDVB que los “stem loop” Ia y Ib en la región 5' NCR eran totalmente prescindibles para una traducción eficiente, mientras que el “stem-loop” IIIe y la horquilla final de la zona IIIb fueron sólo requeridas parcialmente. Por el contrario, supresiones o inserciones en cualquiera de las otras cuatro estructuras de “stem-loop”, los dominios II, IIIa, IIIc y IIId, provocan reducciones de casi 10 veces de la actividad del IRES. Modificaciones estructurales dentro de la porción distal del dominio IIIb y IIIe correlaciona con un bajo nivel de conservación de la secuencia de estas regiones entre los pestivirus [198]. Fletcher y Jackson (2002) observaron que una deleción de nucleótidos en el segmento que comprende el dominio II y el dominio IIIc [124, 125] produce una disminución de la actividad IRES al 19% [199]. Esto señala la importancia de estas estructuras para la función del IRES [197]. Al igual que en estudios previos [124, 125, 199], Thurner et al., 2004, confirmó al dominio III como una importante estructura del IRES de Pestivirus [197]. Fletcher y Jackson, 2002, demostraron a través de deleciones en la región 5’ NCR del genoma del VPPC que el límite del IRES estaba cerca del nucleótido 65: por lo tanto, el IRES incluye la totalidad de dominio II, pero no las secuencias rio arriba de dicho dominio (dominio Ia y Ib). Deleciones que involucran al dominio II, aún en pequeña medida reducen la actividad a cerca del 20% con respecto de la actividad de la estructura completa, y esta actividad residual del 20% persistie aún con deleciones más amplias incluso cuando la totalidad del dominio II había sido removida y pero cuando la deleción involucró el “pseudoknot” (formado por el “stem-loop” IIIf y el extremo 3’ de 5’ NCR), la actividad IRES se redujo a cero. El “pseudoknot” es importante no sólo en la función del IRES de VPPC [199], sino también para VDVB [198]. Por último, se observó que la secuencia del dominio altamente conservado IIIa es, más bien sorprendentemente, no importante para el mantenimiento de la plena actividad IRES [199]. El análisis de la estructura secundaria de 5’NCR de la cepa 511 y NADL, revela una conservación de los dominios que son descritos para esta región, es decir se observan los dominios I (a y b), II y III, siendo los más importantes el dominio II y III [124, 125, 197, 199]. Al analizar la estructura casi completa de la región 5’ NCR de la cepa 511 en relación a la cepa NADL y la estructura secundaria del dominio III en la región 5’NCR (secuencia entre nt 141-373, según cepa de referencia NADL) de las cepas del subtipo 1b (113 y 1025) y 1j (1087) de este estudio, observamos que el dominio IIIf se encuentra en las cepas 113 y 1025 (indicado con una flecha roja en la Figura Nº 7) y no en la cepa 1087, lo que indicaría que las diferencias replicativas encontradas no podrían ser atribuidas a esta estructura, sobre todo debido a que la cepa 1087, al igual que la cepa NADL que tampoco posee el dominio IIIf (Figura Nº 6), son de las más eficientes en términos replicativos (cinética de un paso). Además, analizando el dominio III en su totalidad se observa gran conservación del resto de los “stem-loop” descritos para esta región genómica en las cepas 1b y 1j, por lo que en conclusión no se observar diferencias genómicas ni a nivel de estructura secundaria para 5’ NCR relevantes y que pudieran explicar las diferencias replicativas observadas en las cinéticas de crecimiento. Análisis de la región 3’ NCR Al igual que en la región 5’ NCR se realizó un análisis genómico y de estructura secundaria de una zona de la región 3’ NCR para las 9 cepas en estudio. En general, se observa una gran variabilidad en la región 3’NCR entre las distintas cepas analizadas, incluso con longitudes variables (ver en Anexo Figura Nº 6). No se observan regiones conservadas a excepción de los 22 nt terminales de la región secuenciada con 19 nt conservados para este segmento (ver en Anexo Figura Nº 6), observando el mismo patrón de conservación en un alineamiento de las cepas autóctonas incluidas en el estudio y las cepas de referencia (ver en Anexo Figura Nº 7) en el mismo sector genómico, lo que evidencia que este segmento podría ser importante en la replicación del VDVB. Analizando los porcentajes de identidad nucleotídica entre los 9 aislados virales chilenos utilizados en este estudio se observa una mayor variabilidad en la zona 3’NCR que la región 5’ NCR. Los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 56 y 73% (ver en Anexo Tabla Nº 4). Esta variabilidad se ha observado tanto en cepas de VDVB como comparando este virus con VPPC [124, 125]. Interacciones intramoleculares de secuencias de ARN como estructuras “pseudoknot”, o el alineamiento de bases, incluso a larga distancia, entre secuencias de las regiones 5’ y 3’ NCR, han sido descritos como una característica funcional importante en una serie de virus ARN de una sola hebra para la modulación de la traducción, replicación y procesos de encapsidación [200]. Tales interacciones también son presumidas en flavivirus y pestivirus [197]. Según Thurner et al., 2004 los pestivirus son muy homogéneos estructuralmente en su región 3' NCR, con extensas inserciones ricas en UA. La única característica compartida entre todas las secuencias disponibles es el “stem-loop” terminal o dominio I que fue descrito originalmente por Deng y Brock (1993) [124, 125, 197] y luego por otros autores [200]. Yu et al. en 1999, empleando un ARN subgenómico del VDVB (DI9c) que funciona como un replicón de ARN autónomo, determinaron la estructura secundaria de la región 3’ NCR y estableció la importancia de los motivos de ARN para la replicación del ARN. Su estudio reveló que la parte terminal conservada (denominado 3’C) del 3’ NCR DI9c poseía motivos de ARN distintivo, es decir, un estable “stem-loop”, SL I (o dominio I como lo denominó [124, 125]) cerca del extremo terminal de 3’ y un mucho menos estable “stem-loop”, SL-II, que abarca la porción de 5’ del 3’C. SL-I y SL-II están separados por una larga cadena simple, que se denota como SS. Mediante mutagénesis del ARN DI9c se demostró que el SL-I y el motivo SS desempeñan un papel esencial durante la replicación del ARN. La deleción de la región “stem” que debería mantener el plegamiento general del SL I, así como la sustitución de algunos nucleótidos de la hebra de una sola cadena situados en la región SS o en la región “loop” de SL-I, dio origen a las variantes DI9c incapaces de replicar su genoma [200]. Las mismas conclusiones obtiene Pankraz et al. (2005), al realizar una serie de deleciones de 4 pb y deleciones de cada uno de los “stem loop” introducidos en un clon infeccioso de cDNA de VDVB. Pudo establecer que, el “stem-loop” I y la zona de hebra simple de transición entre el “stem-loop” I y II son indispensables para la replicación pestiviral. Por el contrario, deleciones dentro de SL-II y SL-III, así como la ausencia de cualquiera de ellas, mantiene una replicación viral eficiente. Estos resultados indican lo esencial y no esencial dentro de la región 3' NCR del VDVB para la replicación viral y contribuye a la comprensión de las secuencias y los elementos estructurales importantes para una replicación viral eficiente de los pestivirus [201]. De acuerdo con los datos funcionales, parece probable que los nucleótidos GU (162 y 163) del “hexaloop” de SL I y GCAC (125 a 128) de la secuencia SS pueden representar sitios de interacción con proteínas virales y/o celulares durante la replicación del ARN viral [200]. En esta tesis sólo se pudo comparar la región SS entre SL I y SL II, ya que la región amplificada de 3’ NCR no incluía a la región SL I. En los resultados obtenidos se observa que pese a la gran variabilidad nucleotídica, expresada por las diferentes longitudes y los PIN de cada una de las cepas pertenecientes a cada subtipo, observada en la zona analizada de la región 3’ NCR para las cepas de este estudio, la estructura secundaria se mantiene prácticamente inalterable con 3 “stem-loop” bien definidos, como lo evidencia la Figura Nº 8 para los subtipos 1b y 1j de VDVB. Esta conservación de la estructura secundaria se mantiene en las demás cepas pertenecientes a los distintos subtipos de los aislados nacionales de VDVB analizados en este estudio, a excepción de la cepa 809 que presenta dos “stem loop” para la zona secuenciada (ver en Anexo Figura Nº 8). Por otra parte, la zona genómica terminal de la región 3’ NCR secuenciada esta altamente conservada en las 9 cepas analizadas en este estudio y en estas cepas en relación a aislados de referencia a nivel internacional para cada subtipo (ver en Anexo Figura Nº 6 y 7). Esta región esta compuesta por la secuencia nucleotídica ACAGCACUUUA común a VDVB y VPPC [124, 125] y con una gran conservación en las cepas analizadas, excepto en la cepas 1087 y 511 que poseen una secuencia para esta región AUAGCACUUUA con una mutación y la cepa 809 que posee una secuencia UAAGCACUUUA con dos mutaciones. Sin embargo, estas mutaciones no alteran la estructura secundaria de la cepa 511, lo que sí sucede con la cepa 809 que tiene una estructura secundaria distinta en la región secuenciada de 3’NCR ( ver Figura Nº 6 en Anexo). Análisis de la región Erns En relación a 5’ NCR y 3’ NCR, la región genómica que codifica para la proteína Erns presenta una mayor conservación nucleotídica en las cepas utilizadas en este estudio. La región de Erns secuenciada fue de 651, exceptuando las cepas 113 y 511 en que se secuenció 637 nt, esto corresponde a la secuencia casi completa de la región codificante para la proteína Erns (681 nt en la cepa de referencia NADL) (Ver en Anexo Figura Nº 9) y esencialmente comprende la totalidad de los sitios funcionales, ya que esta proteína además de ser estructural presenta actividad RNAsa y una estructura homodimérica [191]. Al analizar las secuencias nucleotídicas de Erns de los aislados virales chilenos analizados en esta tesis se observa una mayor conservación en la región Erns que las regiones 5’NCR y 3’NCR. Los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 72 y 74%. Al igual que en la región 3’NCR, la mayor conservación nucleotídica en las cepas de genotipo 1 de VDVB se observa entre los subtipos 1a y 1i (90-98% en 3’NCR y 89-99% para Erns) (Ver en anexo Tabla Nº 5). Según algunas publicaciones, el fenotipo CP se caracteriza por una pérdida de control de la replicación del genoma y una disminución de la capacidad de evitar, en la célula infectada, la respuesta de interferón tipo I (IFN-I) por la producción de RNA de doble hebra (dsRNA) producto de la replicación viral. Esto se debería principlamente a un falta de regulación temporal en la producción de NS3, que tiene actividad serina-proteasa y que se produce principalmente al inicio de la replicación viral, como proteína temprana, para luego bajar su síntesis [55, 202]. Por lo tanto, que los virus CP no puedan bloquear la respuesta de IFN inducida por dsRNA, es probable que sea una consecuencia, al menos en parte, de una mayor replicación del ARN [35, 55, 202]. Todas las cepas utilizadas en nuestro estudio son cepas NCP por lo que no habría variabilidad en este aspecto. Se ha establecido que Erns tendría un rol importante en la virulencia y patogenicidad del VDVB, ya que al mutar Erns en pestivirus recombinantes, estos virus se comportan clínicamente como virus atenuados. Esto se ha observado en virus mutantes que carecen de los sitios de N-glicosilación, ubicados cerca de la región N-terminal (Mut1) [203] y también en, virus mutantes sin la actividad RNasa de Erns (Mut2) [189]. Sin embargo, si bién Mut1 [203], presenta su capacidad replicativa disminuida, no ocurre lo mismo con Mut2 [189]. Ha sido propuesto un rol importante de Erns y de su actividad RNasa, en la interacción del virus con el sistema inmune del hospedero o la célula hospedadora, ya que se ha demostrado que Erns interfiere con la respuesta celular a IFN tipo I inducido por dsRNA, y esta actividad es dependiente de la actividad RNasa y su capacidad de unir dsRNA [61, 189]. Recientemente, se ha proporcionado convincente evidencia para VDVB de que la actividad RNAsa de Erns (mutante en codón 349 como lo que sucede en nuestro estudio en los subtipos 1j) y la proteína Npro tienen un papel esencial en el bloqueo de la inducción de IFN-I y el establecimiento de la infección persistente por un pestivirus en el huésped natural [188]. Estudios recientes confirman que las proteínas virales Npro y Erns tienen la capacidad de reprimir la respuesta de IFN tipo I en la célula hospedera y por lo tanto interferir con la respuesta inmune innata a la infección con pestivirus [61, 188]. Npro interactúa bloqueando a IRF-3, estimulando su degradación proteososmal e IkB induciendo una represión de la respuesta inmune antiviral mediada por IFN tipo I en la célula infectada [132]. Para la región genómica secuenciada que codifica para la proteína Erns (se compararon los primeros 212 aminoácidos codificados por los primeros 636 nt desde el extremo 5’ hacia 3’ de un total de 227 que posee esta proteína) en las cepas autóctonas de VDVB se observa en el análisis aminoacídico que, en general, existe una mayor variabilidad de las cepas genotipo 1 vs la cepa 809 del genotipo 2, que dentro de las cepas del genotipo 1 de VDVB (Figura Nº 9). Sin embargo, más que la variabilidad aminoacídica entre cepas, lo más notable se obtiene analizando los sitios funcionales que le dan a la proteína Erns la actividad RNAsa. Los sitios activos de la proteína se ubican en los aminoácidos situados en posición 30, 74 y 79 (enmarcados en color rojo en la Figura Nº 9) o según su posición en la poliproteína 310, 344 y 349 [61, 188-191]. Estos aa corresponden a tres histidinas (H) que, en general, se encuentran muy conservadas en las cepas analizadas en este estudio, ya que cualquier mutación supondría una alteración de la actividad RNAsa de la proteína. Sin embargo, en las cepas 511 y 1087 se observa una mutación en la posición 79 (Y por H enmarcado en color verde en la Figura Nº 9) y que para este estudio, por las cepas analizadas, se encontraría conservada para el subtipo genético. Para comprobar si esta mutación podría alterar la funcionalidad de la proteína Erns en las cepas del subtipo 1j, se realizó un ensayo en células MDBK (ver protocolo en Anexo) para determinar si esta variación genómica y aminoacídica, se expresaba en una actividad funcional alterada de las cepas poseedoras de la mutación (511 y 1087 del subtipo 1j): Al determinar la actividad RNAsa de los virus de los subtipos 1b y 1j (ver Títulos obtenidos en Anexo Figura Nº 16), se evidencia una abolición total de la actividad RNAsa en las cepas 1j expresando una actividad similar a la presente en los cultivos sin infectar, mientras las cepas 1b (113 y 1025) y la cepa NADL (1a) expresan niveles similares de actividad (entre 0,6 a 0,8) (Figura Nº 14). Probablemente, la ausencia de actividad RNasa en las cepas 1j se debería al cambio aminoacídico detectado en el sitio activo donde radica la funcionalidad RNasa de la proteína Erns. El resultado es igual al obtenido por Meyers et al., 2007 que construyó un mutante que posee una mutación en el mismo sitio de la proteína Erns, en donde pese a eliminarse la actividad RNasa, la mutación no afectó la capacidad replicativa del virus [188]. Lo que no concuerda entre los resultados obtenidos anteriormente y los obtenidos en esta Tesis, es la atenuación que sufren las cepas que poseen la actividad RNAsa de Erns alterada [189]. La cepa 511, que poseía la mutación, fue aislada desde un feto abortado en campo. De hecho se observa una marcada asociación entre las cepas 1j y cuadros reproductivos en las hembras bovinas muestreadas, ya que de los 20 aislados virales de este subgrupo, 11 de ellos fueron obtenidos desde animales con este tipo de patología. Por otra parte, la mutación podría explicar el menor diámetro de los focos de infección obtenidos en el ensayo de diseminación célula a célula en las cepas 511 y 1087 en relación a las cepas 1b, ya que las cepas del biotipo 1j no podrían evadir la respuesta inmune innata producida por la producción de interferón tipo I, lo que limitaría la infección a las células vecinas. El residuo de cisteína en la posición 171 de la proteína Erns es clave en la formación de homodímeros de Erns a través de puentes disulfuros entre dos monómeros de la proteína [191]. Hay muy pocas cepas de pestivirus, entre éstas la cepa de referencia NADL, que carecen de C171, lo que demuestra que la formación de homodímeros Erns vinculados a través de C171 no es esencial para la viabilidad de pestivirus. Este hecho plantea la pregunta de si los homodímeros Erns, en general, son prescindibles para la propagación de pestivirus o si la unión no covalente de dímeros todavía está presente en ausencia de C171 [132]. Estos homodímeros se encuentran tanto en las células infectadas, como en las partículas virales [42]. La homodimerización también podría ser importante en el contexto de la función RNasa de Erns como un factor de virulencia, ya que la RNAsa bovina seminal (BS), otra RNasa dimérica con actividad biológica, es dependiente de su estatus dimérico para ejercer su función, a pesar de que los monómeros también presentan actividad RNasa [191]. Tews et al., 2009 probó que la mutación o deleción de Cisteina 171 (Figura Nº 9 enmarcado en color celeste) en VPPC, residuo comprometido en la formación de puentes disulfuro, resulta en pérdida de la homodimerización de Erns, probado por coprecipitación y análisis de proteína nativa en gel de electroforesis. Los virus mutantes, con el cambio en el codón 171, se multiplican casi normalmente en cultivo, exhiben un fenotipo RNAsa positivo e incluso, se comportan como virus atenuados al infectar cerdos, aunque claramente replican e inducen una respuesta inmune significativa de anticuerpos neutralizantes en los animales inoculados [204]. Aunque naturalmente pocos pestivirus expresan proteínas Erns que carecen de C171, está claro que la dimerización vía puente disulfuro de la proteína no es necesario para el mantenimiento de la viabilidad viral, como se reportó anteriormente para VPPC [13]. Aunque se puede obtener virus viables con el codón C171 mutado, hay muy pocas secuencias de pestivirus en Genbank con bases nucleotídicas distintas en esta posición. Además de VDVB NADL, otras dos secuencias de VDVB-1, ILLC y Ind S1449, así como las cepas vacunales contra la peste porcina clásica, Riems y LPC, carecen de cisteína en la posición 171. Curiosamente, para las vacunas de peste porcina clásica y VDVB NADL existen también variantes en GenBank que contienen C171, lo que indica que podría haber variantes en los aislados, como hemos encontrado la cepa de VDVB NADL, ATCC VR534. El alto grado de conservación del residuo C171 en pestivirus indica que los homodímeros de Erns tienen un efecto positivo para el virus durante su replicación en los hospederos naturales [204]. Como se puede observar en la Figura Nº 9, todas las cepas analizadas en este estudio presentan C en la posición 171 (C438 o C441 en la poliproteína del virus de la VPPC o VDVB, respectivamente según [204]), según la secuencia nucleotídica obtenida para cada una de las cepas estudiadas. Por lo tanto, en este aspecto habría una estructura conservada que mantendría la capacidad de la proteína de homodimerizar, lo que preservaría la funcionalidad de la proteína en todas las cepas incluidas en el estudio, según este aspecto de análisis. En resumen para las cepas analizadas en nuestro estudio encontramos una conservación en el residuo requerido para la homodimerización (C171) y una conservación en los sitios activos necesarios para la actividad RNAsa de todas las cepas secuenciadas, excepto las cepas 1j (511 y 1087) que poseen una mutación en el codón 79 (349 en la politproteína) que elimina la actividad RNAsa de Erns. Por último, las variaciones observadas en este estudio en este segmento genómico se deberían haber generado por mutaciones o acumulaciones de estas y no por recombinaciones moleculares. Además consideramos que este es el hallazgo más notable de nuestro estudio y que se contrapone con la información obtenida desde el análisis realizado en otras cepas de VDVB en incluso en investigaciones realizadas en VPPC. Análisis de la región NS3 En el análisis de la región genómica que codifica para la proteína NS3, observamos que a diferencia de la proteína Erns que posee cierto grado de conservación nucleotídica y aminoacídica, la región codificante de la proteína NS3 tiene una gran conservación nucleotídica y una aún mayor conservación aminoacídica. Analizando los porcentajes de identidad nucleotídica entre los aislados virales chilenos utilizados en este estudio, NS3 presenta la mayor conservación con respecto a todas las zonas genómicas analizadas, Erns, 5’NCR y 3’NCR (de menor a mayor variabilidad genómica), especialmente la porción N-terminal de NS3, que además es la porción funcional de la proteína Al igual que lo observado por Xia et al., 2007, los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 82 y 99% (ver en Anexo Tabla Nº 6), presentándose como la región mas conservada genómicamente [205]. Para la región genómica secuenciada que codifica para la proteína NS3, se compararon los aminoácidos codificados entre la posición 169 y 386 hacia el extremo N-terminal de la proteína de las cepas autóctonas de VDVB, porción que presenta la actividad enzimática de serina-proteasa y helicasa/NTPasa que posee NS3. El lugar de corte en NS 2/3 y la producción de una proteína NS3 discreta varía entre los pestivirus aislados [48]. Clivajes rio abajo en la región NS de pestivirus (en los sitios 3/4A, 4A/4B, 4B/5A y 5A/5B) parecen estar mediados por una actividad serina proteinasa presente en el primer tercio N-terminal de la región codificante de NS3, además a través de la expresión transitoria de poliproteínas de VDVB truncadas se ha demostrado que una sustitución de alanina por serina putativo (Ser-1842) suprime la escisión en los cuatro sitios de corte río abajo de NS3 [57]. La necesidad de NS3 para la replicación de pestivirus es corroborado por Lackner et al., 2004, que presenta evidencia del autoprocesamiento de NS2-3 por una recientemente identificada región cisteína proteasa en NS2 que está distantemente relacionada con la autoproteasa NS2-3 del virus de la hepatitis C y virus GB, lo que establece el papel fundamental de este autoproteasa en la infección por el VDVB, que no puede ser aportada por NS2-3. Además, a tiempos tempranos de infección se observa el procesamiento casi completo de NS2-3 en cepas NCP de VDVB, lo que revela una modulación temporal de este clivaje, algo que ya había sido esbozado en un estudio realizado por Kummerer et al., en la cepa Oregon de VDVB en 1998 y que podría estar mediado por el cofactor celular JIV, siendo un proceso regulatorio crucial del ciclo de vida de pestivirus [55, 202, 206]. Esto porque además, la morfogénesis de partículas depende de la producción de NS2-3 sin clivar, como lo demuestra [56]. Xu et al., 1997, estableció la funcionalidad de la actividad serina proteasa de la proteína NS3 de pestivirus, utilizando clones de cDNA de la cepa NADL de VDVB a tiempos tempranos de infección se observa el procesamiento casi completo de NS2-3 en cepas NCP de vDVB, en que determinó la especificidad del sitio de corte de la proteasa pestiviral, comparándola con las de otros miembros de los Flaviviridae. Además, identificó los residuos conocidos o predichos que contribuirían a la especificidad del bolsillo de unión para la función serina proteasa que incluyen los aminoácidos en posición 189, 190, 213, 216, y 228. El sitio de especificidad en el modelo proteinasa del VDVB es similar a los de elastasa y quimotripsina: con G (glicina) en la posición 216 resultando en un bolsillo más profundo, pero N (asparragina) en la posición 190 limita su anchura [58]. Al analizar los sitios funcionales de la región genómica secuenciada, observamos que hay una conservación total en todas las cepas para los aminoácidos que componen el bolsillo de unión y el sitio activo para la función de NS3 como serina-proteasa [58], es decir en los sitios 189, 190, 213, 216 y 228 se sitúan los aminoácidos K, N, V, G y S respectivamente (enmarcados en color verde en la Figura Nº 10); aunque se produce un cambio con respecto a la serina-proteasa de la cepa NADL en la posición 228 que posee I y que para las cepas de nuestro estudio mutó a S, esta mutación entre las cepas (NADL y las autóctonas) se conserva en todas las cepas de VDVB analizadas. Además la S ubicada en la posición 195 [67] y que es el sitio activo que cumple la función de serina-proteasa, se conserva en todas las cepas autóctonas comparadas. Además de la función de serina proteasa, NS3 posee actividades helicasa y NTPasa [138] que son esenciales para la replicación del ARN viral [67, 68]. La secuencia DEYH representa uno de los motivos de secuencia de aminoácidos conservados mejor caracterizados, clasificando la proteína NS3 de VDVB como un miembro de la superfamilia II de helicasas box DEAD/DExH [192]. Las proteínas de esta familia participan en una variedad de actividades bioquímicas involucrando ADN y ARN, que incluyen traducción, transcripción, splicing, recombinación y replicación [67]. El aspartato N-terminal estaría implicado en la unión y orientación del Mg2+-ATP sustrato [68]. Mientras que la histidina C-terminal parece ser necesaria para el acoplamiento de la actividad ATPasa a la actividad de desenrollar la unión del polinucleótido y/o dúplex de ácidos nucleicos [58]. Grassmann et al., 1999, evaluó tres mutantes de proteínas NS3, dos con una caja DETH o DEFH en los que encontró que presentaban una actividad exclusivamente helicasa que corresponde a sólo al 65 y 75% del nivel de la cepa silvestre, respectivamente y un mutante en el C-terminal con una inserción DRRV2191 que probablemente altera el sitio de corte NS3/4A por lo que también disminuye la funcionalidad de NS3 sin afectar la actividad proteasa de la proteína [67]. Curiosamente, el 3’ terminal del genoma todas las cepas de VDVB estudiadas en esta Tesis exhiben características estructurales que cumplen con los requisitos esenciales para la actividad helicasa NS3 in vitro [138], es decir, una estructura estable de stem loop y residuos de bases no-pareados en la parte inmediata del término del 3’ [200]. Las funciones de NS3 no pueden ser transcomplementadas lo que apoya la idea de que las funciones establecidas de NS3 se limitan a productos que operan preferentemente en cis y/o puede exhibir una capacidad limitada para difundir hacia otras plantillas debido a la formación de un complejo cerrado o a una asociación directa o indirecta con estructuras localizadas, por ejemplo, las membranas celulares [67]. Gu et al., 2000 describe otros dos sitios funcionales que tienen actividad helicasa/NTPasa através de mutaciones, por ejemplo el residuo de lisina en el motivo Walker A (GKT en VDVB), que une el grupo fosfato terminal del cofactor NTP, se cambió por una alanina (GAT), el residuo histidina en el motivo Walker B (DEYH en VDVB ya descrito por [67]) responsable de la coordinación del Mg2+ del complejo Mg-NTP se cambió a un alanina (DEYA) [192]. Además de un cambio similar que se ha realizado para disociar actividades helicasa y NTPasa en la helicasa NS3 del VHC, la supresión de 18 residuos (residuos de 2174 a 2190 de la poliproteína) que abarca al motivo VI (QRRGRVGR) también fue evaluado [68]. Por ultimo, Buckwold et al. (2003) describe, además de las zonas descritas anteriormente, otras regiones asociadas a la actividad helicasa/NTPasa como KGWSGLP, VLIPLRAA, VAMTATPA (en orden a su ubicación desde 5’ a 3’) a través de la comparación de la secuencia de NS3 de HCV-1 con la cepa NADL de VDVB, muchas de ellas sin una función específica aun determinada [192]. Al comparar los sitios descritos para la función helicasa/NTPasa, encontramos que los motivos descritos bibliográficamente que presentan estas actividades como KGWSGLP, GRVVGR, VLIPLRAA, VAMTATPA, TGAGKT, y DEYH (enmarcados en color rojo en la Figura Nº 10), se encuentran en todas las secuencias de las cepas autóctonas analizadas y más importante aún, no existen mutaciones en los sitios funcionales, lo que evidenciaría una conservación extrema, revelando un rol primordial de NS3 en la replicación viral de las cepas analizadas. En conclusión, la región analizada de la proteína NS3 presenta una gran conservación nucleotídica y una aún mayor, conservación aminoacídica en los sitios funcionales estudiados, para todas las cepas autóctonas de VDVB analizadas, lo que revela el rol esencial de esta proteína en el ciclo replicativo viral. Además se analizó la porción C-terminal de la proteína NS3, una región que corresponde a los últimos 109 aa (327 nt) codificados de la proteína (entre los aa 574-682 inclusive), que presentó un perfil nucleotídico y aminoacídico muy similar a la región cercana al extremo N-terminal de NS3 analizada anteriormente. Los PIN obtenidos de los aislados virales chilenos utilizados en este estudio se muestran en anexo en la Tabla Nº 7. Aunque la conservación nucleotídica se mantiene, es en un porcentaje menor que en la región próxima al extremo N-terminal de NS3 (de 3 a 4,5%). Otro aspecto importante es que presenta una gran cantidad de aminoácidos apolares (50%), ver en Anexo Figura Nº 13, ya que esta región se une a membrana para facilitar la actividad enzimática de NS3 en el complejo replicativo viral [193]. Además, según Grassmann et al. (1999) este dominio puede representar otro determinante funcional no caracterizado de NS3 que, por ejemplo, podría servir como un coparticipe de la interacción de otros factores celulares o virales durante el ensamblaje del complejo de replicación. Aunque experimentos adicionales son necesarios para validar esta atractiva hipótesis [67]. Otra región secuenciada fue la codificante de NS4A, de la cual se conoce poco de su función, aunque experimentos de transprocesamiento implican a los 54 residuos de la proteína NS4A como cofactor de la proteasa NS3 necesarios para la escisión en los sitios 4B/5A y 5A/5B [58], siendo catalogado como un componente integral del complejo serina proteasa de NS3 [56]. El alineamiento de la secuencia nucleotídica y comparación aminoacídica la podemos observar en la Figura Nº 14 (ver en Anexo), donde se evidencia que esta zona también presenta un alto grado de conservación genética y aminoacídica en las cepas analizadas, al igual que NS3, lo que podría deberse a las características funcionales de esta proteína. Análisis de la región E2 Al analizar la zona secuenciada de la región genómica que codifica para la proteína E2, observamos que a diferencia de la proteína Erns y NS3 que posee un alto grado de conservación nucleotídica y aminoacídica, la región codificante analizada de la proteína E2 tiene la mayor variabilidad nucleotídica y aminoacídica de las zonas codificantes comparadas. La proteína E2 posee 407 aa (1221 nt), según la secuencia de la cepa de referencia NADL. En este estudio analizamos la secuencia nucleotídica y aminoacídica de una porción hacia el extremo 5’ de la región genómica de E2, 420 nt, que codifican un segmento hacia la porción N-terminal de la proteína entre aa 140 y 279 (ver en Anexo Figura 15 posición en la poliproteína 831 a 970 en la cepa de referencia NADL). NS3 y 5’UTR como las regiones más conservadas analizadas hasta el momento, con una proporción de sitios conservados de 58% y 53%, respectivamente, mientras que E2b es la región más variable con sólo el 9% de sitios conservados [205]. Esto indicaría que la proteína E2 posee una gran variabilidad nucleotídica y probablemente aminoacídica, porque es una de las proteínas más inmunogénicas del virus [58], que posee una presión de selección, que promueve la variabilidad genética y aminoacídica. Además, esta proteína es utilizada como ligando para el receptor celular [134]. La alta variabilidad antigénica de E2 incluso se ha demostrado en individuos persistentemente infectados que cursan con enfermedad de las mucosas, lo que reafirma la hipótesis que durante la infección viral cosntantemente se producen cuasiespecies virales lo que produce una selección de una población viral con variaciones antigénicas, que es capaz de eludir el sistema inmunológico del hospedador [207] . Analizando los porcentajes de identidad nucleotídica entre los 9 aislados virales chilenos utilizados en este estudio se observa la mayor variabilidad encontrada de las regiones codificantes analizadas. Los virus de los genotipos VDVB-1 y VDVB-2 presentan un PIN intergenotipo entre 63 y 67% (ver en Anexo Tabla Nº 8). van Rijn (2007) sugiere una estructura y funcionalidad de E2 similar entre todas las especies de pestivirus, sin embargo, el porcentaje global de homología de la mitad N-terminal de E2 puede ser tan bajo como un 40% [208]. Aminoácidos esenciales para epítopes completamente conservados de VPPC-E2, como Pro833, no están presentes en virus noPPC [76]. Sorprendentemente, noPPC-E2 contienen otros dos residuos Cys en la mitad antigénica N-terminal en comparación con el VPPC-E2. Esto podría implicar un puente disulfuro extra, o una formación de pares de enlaces disulfuro completamente diferentes [208]. Ambos podrían dar lugar a diferencias significativas en la estructura antigénica E2. De hecho, informes anteriores indican que la estructura antigénica de no CSFV-E2 es diferente a la de PPC-E2 [169]. En resumen, por una parte hay reportes que indican diferencias importantes entre las E2 del virus de la PPC y noPPC; y por otro lado, otros reportes indican similitudes entre E2 de pestivirus diferentes especies [208]. Xia et al. (2007) describe a E2a con una mayor conservación que E2b, incluso sugiere que podría utilizarse en análisis filogenético de preferencia por sobre 5’NCR [205]. En la cepa Alfort/187, de VPPC se ha descrito un epítope específico que discrimina de VDVB y vBD ya que el epítope es reconocido por un anticuerpo monoclonal (WH303) con afinidad por diferentes cepas de virus de la PPC, pero no para los otros miembros del Género Pestivirus, el virus de la diarrea viral bovina (DVB) y virus de la enfermedad de la frontera (vBD), cuya secuencia corresponde a TAVSPTTLR (aa 829 a 837) de E2 [209]. Para la región genómica secuenciada que codifica para la proteína E2, observamos en el análisis aminoacídico que existe, como era esperable, una gran variabilidad en la secuencia, siendo observados sólo pequeños segmentos de conservación aminoacídica, LGGNWTC, CKWCG, YPIGKCR, GVAIVP y KLGPMPC (enmarcados en azul en la Figura Nº 13), que podrían tener importancia en la composición estructural de la proteína. Esto además, confirma la gran variabilidad de esta proteína debido a que es la proteína más inmunogénica de VDVB. Aunque reconocemos que no se pueden sacar conclusiones claras con respecto a las secuencias obtenidas que pudieran incidir en la replicación de las cepas de VDVB analizadas, hay características de la replicación que podrían estar determinadas por la secuencia de E2, como por ejemplo, la diferencia en virus residual de las distintas cepas de nuestro estudio, que implica una adsorción de la partícula viral sin penetración celular o la mayor eficiencia en diseminación célula a célula de las cepas 1b o la rápida liberación de cepas 1j para producir infección de células del cultivo celular a distancia. Por lo que se hace necesario seguir estudiando esta región genómica primordial de VDVB. Las regiones 5’NCR y 3’ NCR presentan un cierto grado de conservación genética y un mayor grado de conservación de la estructura secundaria de las secuencias analizadas de estas zonas no codificantes. Mientras, NS3 presenta una gran conservación genética y un aún mayor grado de conservación aminoacídica lo que revela el papel esencial que esta proteína cumple en el ciclo replicativo de VDVB En la proteína Erns encontramos la diferencia más notable para las cepas del subtipo 1j con respecto al resto de las cepas analizadas, ya que presentan una mutacion en el codón Y79H (codón 349 en la poliproteína), que disminuye la actividad RNAsa de esta proteína lo que probablemente disminuiría la capacidad de inhibir la respuesta inmune innata de las células infectadas por estas cepas, a través de la imposibilidad de inhibir la producción de IFN tipo I. Esto podría explicar el menor rendimiento de las cepas 1j en la diseminación célula a célula observada en este estudio. Esta mutación se ha asociado a atenuación del virus, lo que en cierta forma es discutible ya que las cepas 1j (si esta mutación fuera conservada para el subtipo, lo que falta por probar) fueron aisladas preferentemente asociados a cuadros reproductivos en bovinos. Por último la proteína E2 se observa como la más variable de las observadas en este estudio, aunque no pudimos obtener conclusiones claras, por las diferencias observadas, en esta región podrían subyacer características diferenciales que pudieran incidir en la replicación de las cepas de VDVB, sobre todo pensando que la proteína E2, es muy importante en la entrada del virus a la célula y su rol en la diseminación célula a célula, así como in vivo determinaría la respuesta inmune del hospedero. Por lo que se hace necesario seguir estudiando esta región genómica esencial de VDVB. En resumen para el objetivo especifico Nº 2, no encontramos diferencias genéticas y/o aminoacídicas que pudieran explicar la mayor eficiencia expresada en ciertos parámetros replicativos de las cepas 1j en relación a las cepas 1b. Los resultados obtenidos en esta tesis no son concluyentes respecto a que alguna de las regiones genómicas analizadas pudiera tener un rol único y excluyente, sobre la mayor capacidad replicativa de la cepa CH511 respecto de las demás cepas analizadas, ya sea porque: 1) no se encontró diferencias en la secuencia nucleotídica, aminoacídica o de estructura secundaria (regiones genómicas 5’ NCR, 3’ NCR y NS3); 2) aunque se observó una alta variabilidad en la región analizada no existía evidencia previa acerca de su incidencia sobre la eficiencia replicativa de VDVB (E2), ó 3) la variabilidad encontrada no tendría incidencia sobre la replicación sino sobre su virulencia, a tráves de la inhibición de la respuesta inmune innata (Erns). Un aspecto importante a considerar, no discutido hasta ahora, se refiere a que la eficiencia replicativa y/o virulencia de los virus, generalmente, no reside en una región genómica única, es así, que diversos estudios realizados en familias virales distintas a VDVB, han corroborado que estas características residen en más de una región genómica específica. En el virus de la Necrosis Pancreática Infecciosa (IPN) se ha demostrado que las proteínas VP2 y VP5 son importantes en la virulencia de la cepa viral [210]. En el caso de virus influenza, la mayor virulencia de la cepa viral se ha asociado a una replicación más eficiente del virus, al igual que lo postulado para VDVB, y esto se debería a características específicas de los genes virales HA, NA, PB1, PB2 NS1 y PB1-F2 [211]. El antecedente de que en diferentes virus animales una mayor eficiencia replicativa o virulencia, se explica por factores multigénicos, es decir, por características genómicas presentes en distintos genes del genoma viral y no sólo en una región genómica específica, plantea la necesidad de abordar el estudio de los determinantes de virulencia del VDVB bajo este prisma. CONCLUSIONES 1. En la curva de multiplicación de un paso, las cepas del subtipo 1j presentan una mayor eficiencia replicativa con respecto a las cepas del subtipo 1b, en duración del ciclo infectivo, rendimiento viral, velocidad de producción de viriones y las pendientes en la fase de crecimiento exponencial (cepas 511 y 1087 vs 113). 2. En la curva de multiplicación de múltiples pasos, las cepas del subtipo 1j presentan una mayor eficiencia replicativa con respecto a las cepas del subtipo 1b, en duración de la multiplicación viral, velocidad de producción de virus infecciosos y rendimiento viral. 3. Las cepas 1b presentaron mayores pendientes que las cepas 1j, en la fase de crecimiento exponencial en la curva de multiplicación de múltiples pasos y una mayor eficiencia en la diseminación célula a célula. 4. La estructura secundaria de las regiones 5’NCR y 3’ NCR no presentan diferencias que pudieran explicar las diferencias replicativas observadas entre cepas 1j y 1b. 5. La secuencia codificante de la glicoproteína E2 se presentó como la más variable de las regiones analizadas, sin embargo no se encontró secuencias que a priori pudieran explicar las diferencias observadas entre cepas autóctonas de VDVB. 6. La región NS3 presenta una gran conservación nucleotídica y sobre todo aminoacídica, lo que refleja su rol replicativo esencial en el VDVB. 7. La totalidad de las cepas analizadas presentan una secuencia aminoacídica que permite la homodimerización de la proteína Erns. 8. Las cepas del subgrupo 1j presentan una mutación en el codón 79 de la proteina Erns, la que suprime la actividad RNAsa del virus, representando la diferencia más clara con los otros virus analizados en esta tesis. 9. Los resultados de esta tesis sugieren que la eficiencia replicativa del VDVB sería multigénica, es decir, no se debería a una región genómica específica, sino que a características genómicas presentes en distintos genes del genoma viral. BIBLIOGRAFIA 1. Olafson P, M.A., Fox A., An apparently new transmissible disease of cattle. Cornell Vet, 1946. 36: p. 205-213. 2. Childs, T., X Disease of Cattle - Saskatchewan. Can J Comp Med Vet Sci, 1946. 10(11): p. 316-9. 3. Ramsey FK, C.W., Mucosal disease of cattle. North Am Vet, 1953. 34: p. 629-634. 4. Jensen, R., Report of an adhoc committee on technology for the sympositum on immunity to the bovine respiratory disease complex. J. Am. Vet. Med. Assoc. , 1968. 152: p. 940 - 948. 5. Radostits, O.M. and I.R. Littlejohns, New Concepts in the Pathogenesis, Diagnosis and Control of Diseases Caused by the Bovine Viral Diarrhea Virus. Can Vet J, 1988. 29(6): p. 513-528. 6. Perdrizet, J.A., W.C. Rebhun, E.J. Dubovi, and R.O. Donis, Bovine virus diarrhea--clinical syndromes in dairy herds. Cornell Vet, 1987. 77(1): p. 46-74. 7. Rebhun, W.C., T.W. French, J.A. Perdrizet, E.J. Dubovi, S.G. Dill, and L.F. Karcher, Thrombocytopenia associated with acute bovine virus diarrhea infection in cattle. J Vet Intern Med, 1989. 3(1): p. 42-6. 8. Broes A, W.G., Dheedene J. and (BVD/MD), Syndrome hémorragique chez des bovines infectés par le virus de la diarrhée virale bovine. Ann Med Vet, 1992. 137: p. 33-38. 9. Horzinek, M.C., The structure of togaviruses. Prog Med Virol, 1973. 16: p. 109-56. 10. Fenner, F., Classification and nomenclature of viruses. Second report of the International Committee on Taxonomy of Viruses. Intervirology, 1976. 7(1-2): p. 1-115. 11. Westaway, E.G., M.A. Brinton, S. Gaidamovich, M.C. Horzinek, A. Igarashi, L. Kaariainen, D.K. Lvov, J.S. Porterfield, P.K. Russell, and D.W. Trent, Flaviviridae. Intervirology, 1985. 24(4): p. 183-92. 12. Collett, M.S., D.K. Anderson, and E. Retzel, Comparisons of the pestivirus bovine viral diarrhoea virus with members of the flaviviridae. J Gen Virol, 1988. 69 ( Pt 10): p. 2637-43. 13. Ridpath, J.F., Bovine viral diarrhea virus: global status. Vet Clin North Am Food Anim Pract, 2010. 26(1): p. 105-21, table of contents. 14. Ridpath, J.F., S.R. Bolin, and E.J. Dubovi, Segregation of bovine viral diarrhea virus into genotypes. Virology, 1994. 205(1): p. 66-74. 15. Pellerin, C., J. van den Hurk, J. Lecomte, and P. Tussen, Identification of a new group of bovine viral diarrhea virus strains associated with severe outbreaks and high mortalities. Virology, 1994. 203(2): p. 260-8. 16. Thiel, H.-J., Collett, M.S., Gould, E.A., Heinz, F.X., Houghton, M., Meyers, G., Purcell, R.H. and Rice, C.M. , Family Flaviviridae, in Virus taxonomy:eigth report of the International Committee on Taxonomy of Viruses., M.H.V.v.R. In C. M. Fauquet, E.B.C. D. H. L. Bishop, M. K. Estes, S. M. Lemon, J. Maniloff, M. A., and D.J.M. Mayo, C. R. Pringle, and R. B. Wickner (ed.), Editors. 2005. 17. Kirkland, P.D., M.J. Frost, D.S. Finlaison, K.R. King, J.F. Ridpath, and X. Gu, Identification of a novel virus in pigs--Bungowannah virus: a possible new species of pestivirus. Virus Res, 2007. 129(1): p. 26-34. 18. Avalos-Ramirez, R., M. Orlich, H.J. Thiel, and P. Becher, Evidence for the presence of two novel pestivirus species. Virology, 2001. 286(2): p. 456-65. 19. Becher, P., M. Orlich, A. Kosmidou, M. Konig, M. Baroth, and H.J. Thiel, Genetic diversity of pestiviruses: identification of novel groups and implications for classification. Virology, 1999. 262(1): p. 64-71. 20. Vilcek, S., J.F. Ridpath, H. Van Campen, J.L. Cavender, and J. Warg, Characterization of a novel pestivirus originating from a pronghorn antelope. Virus Res, 2005. 108(1-2): p. 187-93. 21. Liu, L., H. Xia, N. Wahlberg, S. Belak, and C. Baule, Phylogeny, classification and evolutionary insights into pestiviruses. Virology, 2009. 385(2): p. 351-7. 22. Schirrmeier, H., G. Strebelow, K. Depner, B. Hoffmann, and M. Beer, Genetic and antigenic characterization of an atypical pestivirus isolate, a putative member of a novel pestivirus species. J Gen Virol, 2004. 85(Pt 12): p. 3647-52. 23. Stahl, K., J. Kampa, S. Alenius, A. Persson Wadman, C. Baule, S. Aiumlamai, and S. Belak, Natural infection of cattle with an atypical 'HoBi'-like pestivirus--implications for BVD control and for the safety of biological products. Vet Res, 2007. 38(3): p. 517-23. 24. Stalder, H.P., P. Meier, G. Pfaffen, C. Wageck-Canal, J. Rufenacht, P. Schaller, C. Bachofen, S. Marti, H.R. Vogt, and E. Peterhans, Genetic heterogeneity of pestiviruses of ruminants in Switzerland. Prev Vet Med, 2005. 72(1-2): p. 37-41; discussion 215-9. 25. Houe, H., Epidemiological features and economical importance of bovine virus diarrhoea virus (BVDV) infections. Vet Microbiol, 1999. 64(2-3): p. 89-107. 26. Baker, J.C., Clinical aspects of bovine virus diarrhoea virus infection. Rev Sci Tech, 1990. 9(1): p. 25-41. 27. Lindberg, A., J. Brownlie, G.J. Gunn, H. Houe, V. Moennig, H.W. Saatkamp, T. Sandvik, and P.S. Valle, The control of bovine viral diarrhoea virus in Europe: today and in the future. Rev Sci Tech, 2006. 25(3): p. 961-79. 28. Chase, C.C., L.J. Braun, P. Leslie-Steen, T. Graham, D. Miskimins, and J.F. Ridpath, Bovine viral diarrhea virus multiorgan infection in two white-tailed deer in southeastern South Dakota. J Wildl Dis, 2008. 44(3): p. 753-9. 29. Mingala, C.N., S. Konnai, M. Tajima, M. Onuma, and K. Ohashi, Classification of new BVDV isolates from Philippine water buffalo using the viral E2 region. J Basic Microbiol, 2009. 49(5): p. 495-500. 30. Nelson, D.D., M.J. Dark, D.S. Bradway, J.F. Ridpath, N. Call, J. Haruna, F.R. Rurangirwa, and J.F. Evermann, Evidence for persistent Bovine viral diarrhea virus infection in a captive mountain goat (Oreamnos americanus). J Vet Diagn Invest, 2008. 20(6): p. 752-9. 31. Kim, S.G., R.R. Anderson, J.Z. Yu, N.C. Zylich, H. Kinde, S. Carman, D. Bedenice, and E.J. Dubovi, Genotyping and phylogenetic analysis of bovine viral diarrhea virus isolates from BVDV infected alpacas in North America. Vet Microbiol, 2009. 136(3-4): p. 209-16. 32. Depner, K., O.J. Hubschle, and B. Liess, Prevalence of ruminant pestivirus infections in Namibia. Onderstepoort J Vet Res, 1991. 58(2): p. 107-9. 33. Pizarro-Lucero, J., M.O. Celedon, M. Aguilera, and A. de Calisto, Molecular characterization of pestiviruses isolated from bovines in Chile. Vet Microbiol, 2006. 115(1-3): p. 208-17. 34. Robert, A., F. Beaudeau, H. Seegers, A. Joly, and J.M. Philipot, Large scale assessment of the effect associated with bovine viral diarrhoea virus infection on fertility of dairy cows in 6149 dairy herds in Brittany (Western France). Theriogenology, 2004. 61(1): p. 117-27. 35. Vassilev, V.B., M.S. Collett, and R.O. Donis, Authentic and chimeric full-length genomic cDNA clones of bovine viral diarrhea virus that yield infectious transcripts. J Virol, 1997. 71(1): p. 471-8. 36. Houe, H., Economic impact of BVDV infection in dairies. Biologicals, 2003. 31(2): p. 137-43. 37. Heinz, F.X., M. S. Collett, R. H. Purcell, E. A. Gould, C. R. Howard, M. and R.J.M.M. Houghton, C. M. Rice, and H.-J. Thiel., Family Flaviviridae, in Virus taxonomy: seventh report of the International Committee on Taxonomy of Viruses., M.H.V.v.R. In C. M. Fauquet, E.B.C. D. H. L. Bishop, M. K. Estes, S. M. Lemon, J. Maniloff, M. A., and D.J.M. Mayo, C. R. Pringle, and R. B. Wickner (ed.), Editors. 2000, Academic Press, San Diego, Calif. p. p. 859–878. 38. Becher, P., R. Avalos Ramirez, M. Orlich, S. Cedillo Rosales, M. Konig, M. Schweizer, H. Stalder, H. Schirrmeier, and H.J. Thiel, Genetic and antigenic characterization of novel pestivirus genotypes: implications for classification. Virology, 2003. 311(1): p. 96-104. 39. Becher, P., M. Orlich, A.D. Shannon, G. Horner, M. Konig, and H.J. Thiel, Phylogenetic analysis of pestiviruses from domestic and wild ruminants. J Gen Virol, 1997. 78 ( Pt 6): p. 1357-66. 40. Nettleton, P.F. and G. Entrican, Ruminant pestiviruses. Br Vet J, 1995. 151(6): p. 615-42. 41. Rumenapf, T., G. Unger, J.H. Strauss, and H.J. Thiel, Processing of the envelope glycoproteins of pestiviruses. J Virol, 1993. 67(6): p. 3288-94. 42. Thiel, H.J., R. Stark, E. Weiland, T. Rumenapf, and G. Meyers, Hog cholera virus: molecular composition of virions from a pestivirus. J Virol, 1991. 65(9): p. 4705-12. 43. Ridpath, J.F. and S.R. Bolin, The genomic sequence of a virulent bovine viral diarrhea virus (BVDV) from the type 2 genotype: detection of a large genomic insertion in a noncytopathic BVDV. Virology, 1995. 212(1): p. 39-46. 44. Brock, K.V., R. Deng, and S.M. Riblet, Nucleotide sequencing of 5' and 3' termini of bovine viral diarrhea virus by RNA ligation and PCR. J Virol Methods, 1992. 38(1): p. 39-46. 45. Purchio, A.F., R. Larson, L.L. Torborg, and M.S. Collett, Cell-free translation of bovine viral diarrhea virus RNA. J Virol, 1984. 52(3): p. 973-5. 46. Purchio, A.F., R. Larson, and M.S. Collett, Characterization of virus-specific RNA synthesized in bovine cells infected with bovine viral diarrhea virus. J Virol, 1983. 48(1): p. 320-4. 47. De Moerlooze, L., C. Lecomte, S. Brown-Shimmer, D. Schmetz, C. Guiot, D. Vandenbergh, D. Allaer, M. Rossius, G. Chappuis, D. Dina, and et al., Nucleotide sequence of the bovine viral diarrhoea virus Osloss strain: comparison with related viruses and identification of specific DNA probes in the 5' untranslated region. J Gen Virol, 1993. 74 ( Pt 7): p. 1433-8. 48. Meyers, G., N. Tautz, P. Becher, H.J. Thiel, and B.M. Kummerer, Recovery of cytopathogenic and noncytopathogenic bovine viral diarrhea viruses from cDNA constructs. J Virol, 1996. 70(12): p. 8606-13. 49. Collett, M.S., M. Wiskerchen, E. Welniak, and S.K. Belzer, Bovine viral diarrhea virus genomic organization. Arch Virol Suppl, 1991. 3: p. 19-27. 50. Meyers, G., N. Tautz, R. Stark, J. Brownlie, E.J. Dubovi, M.S. Collett, and H.J. Thiel, Rearrangement of viral sequences in cytopathogenic pestiviruses. Virology, 1992. 191(1): p. 368-86. 51. Ridpath, J.F., J.D. Neill, M. Frey, and J.G. Landgraf, Phylogenetic, antigenic and clinical characterization of type 2 BVDV from North America. Vet Microbiol, 2000. 77(1-2): p. 145-55. 52. Meyers, G. and H.J. Thiel, Molecular characterization of pestiviruses. Adv Virus Res, 1996. 47: p. 53-118. 53. Elbers, K., N. Tautz, P. Becher, D. Stoll, T. Rumenapf, and H.J. Thiel, Processing in the pestivirus E2-NS2 region: identification of proteins p7 and E2p7. J Virol, 1996. 70(6): p. 4131-5. 54. Harada, T., N. Tautz, and H.J. Thiel, E2-p7 region of the bovine viral diarrhea virus polyprotein: processing and functional studies. J Virol, 2000. 74(20): p. 9498-506. 55. Lackner, T., A. Muller, A. Pankraz, P. Becher, H.J. Thiel, A.E. Gorbalenya, and N. Tautz, Temporal modulation of an autoprotease is crucial for replication and pathogenicity of an RNA virus. J Virol, 2004. 78(19): p. 10765-75. 56. Agapov, E.V., C.L. Murray, I. Frolov, L. Qu, T.M. Myers, and C.M. Rice, Uncleaved NS2-3 is required for production of infectious bovine viral diarrhea virus. J Virol, 2004. 78(5): p. 2414-25. 57. Tautz, N., K. Elbers, D. Stoll, G. Meyers, and H.J. Thiel, Serine protease of pestiviruses: determination of cleavage sites. J Virol, 1997. 71(7): p. 5415-22. 58. Xu, J., E. Mendez, P.R. Caron, C. Lin, M.A. Murcko, M.S. Collett, and C.M. Rice, Bovine viral diarrhea virus NS3 serine proteinase: polyprotein cleavage sites, cofactor requirements, and molecular model of an enzyme essential for pestivirus replication. J Virol, 1997. 71(7): p. 5312-22. 59. Hilton, L., K. Moganeradj, G. Zhang, Y.H. Chen, R.E. Randall, J.W. McCauley, and S. Goodbourn, The NPro product of bovine viral diarrhea virus inhibits DNA binding by interferon regulatory factor 3 and targets it for proteasomal degradation. J Virol, 2006. 80(23): p. 11723-32. 60. Seago, J., L. Hilton, E. Reid, V. Doceul, J. Jeyatheesan, K. Moganeradj, J. McCauley, B. Charleston, and S. Goodbourn, The Npro product of classical swine fever virus and bovine viral diarrhea virus uses a conserved mechanism to target interferon regulatory factor-3. J Gen Virol, 2007. 88(Pt 11): p. 3002-6. 61. Iqbal, M., E. Poole, S. Goodbourn, and J.W. McCauley, Role for bovine viral diarrhea virus Erns glycoprotein in the control of activation of beta interferon by double-stranded RNA. J Virol, 2004. 78(1): p. 136-45. 62. Deregt, D., S.R. Bolin, J. van den Hurk, J.F. Ridpath, and S.A. Gilbert, Mapping of a type 1-specific and a type-common epitope on the E2 (gp53) protein of bovine viral diarrhea virus with neutralization escape mutants. Virus Res, 1998. 53(1): p. 81-90. 63. Toth, R.L., P.F. Nettleton, and M.A. McCrae, Expression of the E2 envelope glycoprotein of bovine viral diarrhoea virus (BVDV) elicits virus-type specific neutralising antibodies. Vet Microbiol, 1999. 65(2): p. 87-101. 64. Liang, D., I.F. Sainz, I.H. Ansari, L.H. Gil, V. Vassilev, and R.O. Donis, The envelope glycoprotein E2 is a determinant of cell culture tropism in ruminant pestiviruses. J Gen Virol, 2003. 84(Pt 5): p. 1269-74. 65. Schneider, R., G. Unger, R. Stark, E. Schneider-Scherzer, and H.J. Thiel, Identification of a structural glycoprotein of an RNA virus as a ribonuclease. Science, 1993. 261(5125): p. 1169-71. 66. Windisch, J.M., R. Schneider, R. Stark, E. Weiland, G. Meyers, and H.J. Thiel, RNase of classical swine fever virus: biochemical characterization and inhibition by virus-neutralizing monoclonal antibodies. J Virol, 1996. 70(1): p. 352-8. 67. Grassmann, C.W., O. Isken, and S.E. Behrens, Assignment of the multifunctional NS3 protein of bovine viral diarrhea virus during RNA replication: an in vivo and in vitro study. J Virol, 1999. 73(11): p. 9196-205. 68. Gu, B., C. Liu, J. Lin-Goerke, D.R. Maley, L.L. Gutshall, C.A. Feltenberger, and A.M. Del Vecchio, The RNA helicase and nucleotide triphosphatase activities of the bovine viral diarrhea virus NS3 protein are essential for viral replication. J Virol, 2000. 74(4): p. 1794-800. 69. Choi, K.H., J.M. Groarke, D.C. Young, R.J. Kuhn, J.L. Smith, D.C. Pevear, and M.G. Rossmann, The structure of the RNA-dependent RNA polymerase from bovine viral diarrhea virus establishes the role of GTP in de novo initiation. Proc Natl Acad Sci U S A, 2004. 101(13): p. 4425-30. 70. Kao, C.C., A.M. Del Vecchio, and W. Zhong, De novo initiation of RNA synthesis by a recombinant flaviviridae RNA-dependent RNA polymerase. Virology, 1999. 253(1): p. 1-7. 71. Lai, V.C., C.C. Kao, E. Ferrari, J. Park, A.S. Uss, J. Wright-Minogue, Z. Hong, and J.Y. Lau, Mutational analysis of bovine viral diarrhea virus RNA-dependent RNA polymerase. J Virol, 1999. 73(12): p. 10129-36. 72. Reed, K.E., A.E. Gorbalenya, and C.M. Rice, The NS5A/NS5 proteins of viruses from three genera of the family flaviviridae are phosphorylated by associated serine/threonine kinases. J Virol, 1998. 72(7): p. 6199-206. 73. Ridpath, J.F., BVDV genotypes and biotypes: practical implications for diagnosis and control. Biologicals, 2003. 31(2): p. 127-31. 74. Dekker, A., G. Wensvoort, and C. Terpstra, Six antigenic groups within the genus pestivirus as identified by cross neutralization assays. Vet Microbiol, 1995. 47(3-4): p. 317-29. 75. Harasawa, R., M. Giangaspero, G. Ibata, and D.J. Paton, Giraffe strain of pestivirus: its taxonomic status based on the 5'-untranslated region. Microbiol Immunol, 2000. 44(11): p. 915-21. 76. van Rijn, P.A., H.G. van Gennip, C.H. Leendertse, C.J. Bruschke, D.J. Paton, R.J. Moormann, and J.T. van Oirschot, Subdivision of the pestivirus genus based on envelope glycoprotein E2. Virology, 1997. 237(2): p. 337-48. 77. Bachofen, C., H. Stalder, U. Braun, M. Hilbe, F. Ehrensperger, and E. Peterhans, Co-existence of genetically and antigenically diverse bovine viral diarrhoea viruses in an endemic situation. Vet Microbiol, 2008. 131(1-2): p. 93-102. 78. Lindenbach, B.D. and C.M. Rice, Pestiviruses, in FUNDAMENTAL VIROLOGY, D.M. Knipe, and Howley, Peter. M, Editor. 2001, Lippincott Williams & Wilkins: Philadelphia. p. 614-618. 79. Thiel, H.J., P. Plagemann, and V. Moenning, Pestiviruses, in Fields Virology, B.N. Fields, Knipe, D. M., Howley, P. M., Editor. 1996, Lippincott- Raven: Philadelphia. p. 1059-1073. 80. Vilcek, S., [Development of PCR tests for the detection of bovine herpesvirus-1, bovine respiratory syncytial viruses and pestiviruses]. Vet Med (Praha), 1994. 39(11): p. 687-700. 81. Vilcek, S., D.J. Paton, B. Durkovic, L. Strojny, G. Ibata, A. Moussa, A. Loitsch, W. Rossmanith, S. Vega, M.T. Scicluna, and V. Paifi, Bovine viral diarrhoea virus genotype 1 can be separated into at least eleven genetic groups. Arch Virol, 2001. 146(1): p. 99-115. 82. Arnal, M., D. Fernandez-de-Luco, L. Riba, M. Maley, J. Gilray, K. Willoughby, S. Vilcek, and P.F. Nettleton, A novel pestivirus associated with deaths in Pyrenean chamois (Rupicapra pyrenaica pyrenaica). J Gen Virol, 2004. 85(Pt 12): p. 3653-7. 83. Hurtado, A., G. Aduriz, N. Gomez, B. Oporto, R.A. Juste, S. Lavin, J.R. Lopez-Olvera, and I. Marco, Molecular identification of a new pestivirus associated with increased mortality in the Pyrenean Chamois (Rupicapra pyrenaica pyrenaica) in Spain. J Wildl Dis, 2004. 40(4): p. 796-800. 84. Bolin, S.R. and J.F. Ridpath, Differences in virulence between two noncytopathic bovine viral diarrhea viruses in calves. Am J Vet Res, 1992. 53(11): p. 2157-63. 85. Corapi, W.V., T.W. French, and E.J. Dubovi, Severe thrombocytopenia in young calves experimentally infected with noncytopathic bovine viral diarrhea virus. J Virol, 1989. 63(9): p. 3934-43. 86. Carman, S., T. van Dreumel, J. Ridpath, M. Hazlett, D. Alves, E. Dubovi, R. Tremblay, S. Bolin, A. Godkin, and N. Anderson, Severe acute bovine viral diarrhea in Ontario, 1993-1995. J Vet Diagn Invest, 1998. 10(1): p. 27-35. 87. Baker, J.C., The clinical manifestations of bovine viral diarrhea infection. Vet Clin North Am Food Anim Pract, 1995. 11(3): p. 425-45. 88. Potgieter, L.N., Bovine respiratory tract disease caused by bovine viral diarrhea virus. Vet Clin North Am Food Anim Pract, 1997. 13(3): p. 471-81. 89. Brodersen, B.W. and C.L. Kelling, Effect of concurrent experimentally induced bovine respiratory syncytial virus and bovine viral diarrhea virus infection on respiratory tract and enteric diseases in calves. Am J Vet Res, 1998. 59(11): p. 1423-30. 90. Elvander, M., C. Baule, M. Persson, L. Egyed, A. Ballagi-Pordany, S. Belak, and S. Alenius, An experimental study of a concurrent primary infection with bovine respiratory syncytial virus (BRSV) and bovine viral diarrhoea virus (BVDV) in calves. Acta Vet Scand, 1998. 39(2): p. 251-64. 91. Fulton, R.W., C.W. Purdy, A.W. Confer, J.T. Saliki, R.W. Loan, R.E. Briggs, and L.J. Burge, Bovine viral diarrhea viral infections in feeder calves with respiratory disease: interactions with Pasteurella spp., parainfluenza-3 virus, and bovine respiratory syncytial virus. Can J Vet Res, 2000. 64(3): p. 151-9. 92. Adler, H., T.W. Jungi, H. Pfister, M. Strasser, M. Sileghem, and E. Peterhans, Cytokine regulation by virus infection: bovine viral diarrhea virus, a flavivirus, downregulates production of tumor necrosis factor alpha in macrophages in vitro. J Virol, 1996. 70(4): p. 2650-3. 93. Bruschke, C.J., M.M. Hulst, R.J. Moormann, P.A. van Rijn, and J.T. van Oirschot, Glycoprotein Erns of pestiviruses induces apoptosis in lymphocytes of several species. J Virol, 1997. 71(9): p. 6692-6. 94. Potgieter, L.N., Immunology of bovine viral diarrhea virus. Vet Clin North Am Food Anim Pract, 1995. 11(3): p. 501-20. 95. Duffell, S.J. and J.W. Harkness, Bovine virus diarrhoea-mucosal disease infection in cattle. Vet Rec, 1985. 117(10): p. 240-5. 96. Roeder, P.L., M. Jeffrey, and M.P. Cranwell, Pestivirus fetopathogenicity in cattle: changing sequelae with fetal maturation. Vet Rec, 1986. 118(2): p. 44-8. 97. Fray, M.D., D.J. Paton, and S. Alenius, The effects of bovine viral diarrhoea virus on cattle reproduction in relation to disease control. Anim Reprod Sci, 2000. 60-61: p. 615-27. 98. McGowan, M.R. and P.D. Kirkland, Early reproductive loss due to bovine pestivirus infection. Br Vet J, 1995. 151(3): p. 263-70. 99. Oberst, R.D., Viruses as teratogens. Vet Clin North Am Food Anim Pract, 1993. 9(1): p. 23-31. 100. Bruschke, C.J., A. Haghparast, A. Hoek, V.P. Rutten, G.H. Wentink, P.A. van Rijn, and J.T. van Oirschot, The immune response of cattle, persistently infected with noncytopathic BVDV, after superinfection with antigenically semi-homologous cytopathic BVDV. Vet Immunol Immunopathol, 1998. 62(1): p. 37-50. 101. Brock, K.V., D.R. Redman, M.L. Vickers, and N.E. Irvine, Quantitation of bovine viral diarrhea virus in embryo transfer flush fluids collected from a persistently infected heifer. J Vet Diagn Invest, 1991. 3(1): p. 99-100. 102. Kirkland, P.D., S.G. Richards, J.T. Rothwell, and D.F. Stanley, Replication of bovine viral diarrhoea virus in the bovine reproductive tract and excretion of virus in semen during acute and chronic infections. Vet Rec, 1991. 128(25): p. 587-90. 103. Bolin, S.R., The pathogenesis of mucosal disease. Vet Clin North Am Food Anim Pract, 1995. 11(3): p. 489-500. 104. Fritzemeier, J., L. Haas, E. Liebler, V. Moennig, and I. Greiser-Wilke, The development of early vs. late onset mucosal disease is a consequence of two different pathogenic mechanisms. Arch Virol, 1997. 142(7): p. 1335-50. 105. Tautz, N., G. Meyers, and H.J. Thiel, Pathogenesis of mucosal disease, a deadly disease of cattle caused by a pestivirus. Clin Diagn Virol, 1998. 10(2-3): p. 121-7. 106. Pellerin, C., S. Moir, J. Lecomte, and P. Tijssen, Comparison of the p125 coding region of bovine viral diarrhea viruses. Vet Microbiol, 1995. 45(1): p. 45-57. 107. Corapi, W.V., R.D. Elliott, T.W. French, D.G. Arthur, D.M. Bezek, and E.J. Dubovi, Thrombocytopenia and hemorrhages in veal calves infected with bovine viral diarrhea virus. J Am Vet Med Assoc, 1990. 196(4): p. 590-6. 108. Walz, P.H., T.G. Bell, J.L. Wells, D.L. Grooms, L. Kaiser, R.K. Maes, and J.C. Baker, Relationship between degree of viremia and disease manifestation in calves with experimentally induced bovine viral diarrhea virus infection. Am J Vet Res, 2001. 62(7): p. 1095-103. 109. Kelling, C.L., D.J. Steffen, C.L. Topliff, K.M. Eskridge, R.O. Donis, and D.S. Higuchi, Comparative virulence of isolates of bovine viral diarrhea virus type II in experimentally inoculated six- to nine-month-old calves. Am J Vet Res, 2002. 63(10): p. 1379-84. 110. Liebler-Tenorio, E.M., J.E. Ridpath, and J.D. Neill, Distribution of viral antigen and development of lesions after experimental infection with highly virulent bovine viral diarrhea virus type 2 in calves. Am J Vet Res, 2002. 63(11): p. 1575-84. 111. Mittelholzer, C., C. Moser, J.D. Tratschin, and M.A. Hofmann, Analysis of classical swine fever virus replication kinetics allows differentiation of highly virulent from avirulent strains. Vet Microbiol, 2000. 74(4): p. 293-308. 112. Evermann, J.F. and J.F. Ridpath, Clinical and epidemiologic observations of bovine viral diarrhea virus in the northwestern United States. Vet Microbiol, 2002. 89(2-3): p. 129-39. 113. Baule, C., G. Kulcsar, K. Belak, M. Albert, C. Mittelholzer, T. Soos, L. Kucsera, and S. Belak, Pathogenesis of primary respiratory disease induced by isolates from a new genetic cluster of bovine viral diarrhea virus type I. J Clin Microbiol, 2001. 39(1): p. 146-53. 114. Becher, P., M. Orlich, and H.J. Thiel, Mutations in the 5' nontranslated region of bovine viral diarrhea virus result in altered growth characteristics. J Virol, 2000. 74(17): p. 7884-94. 115. Yu, H., O. Isken, C.W. Grassmann, and S.E. Behrens, A stem-loop motif formed by the immediate 5' terminus of the bovine viral diarrhea virus genome modulates translation as well as replication of the viral RNA. J Virol, 2000. 74(13): p. 5825-35. 116. Makoschey, B., P. Becher, M.G. Janssen, M. Orlich, H.J. Thiel, and D. Lutticken, Bovine viral diarrhea virus with deletions in the 5'-nontranslated region: reduction of replication in calves and induction of protective immunity. Vaccine, 2004. 22(25-26): p. 3285-94. 117. Topliff, C.L., S.K. Chon, R.O. Donis, K.M. Eskridge, and C.L. Kelling, In vitro and in vivo translational efficiencies of the 5' untranslated region from eight genotype 2 bovine viral diarrhea virus field isolates. Virology, 2005. 331(2): p. 349-56. 118. Khromykh, A.A., H. Meka, K.J. Guyatt, and E.G. Westaway, Essential role of cyclization sequences in flavivirus RNA replication. J Virol, 2001. 75(14): p. 6719-28. 119. Hahn, C.S., Y.S. Hahn, C.M. Rice, E. Lee, L. Dalgarno, E.G. Strauss, and J.H. Strauss, Conserved elements in the 3' untranslated region of flavivirus RNAs and potential cyclization sequences. J Mol Biol, 1987. 198(1): p. 33-41. 120. Pestova, T.V., I.N. Shatsky, S.P. Fletcher, R.J. Jackson, and C.U. Hellen, A prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation codon during internal translation initiation of hepatitis C and classical swine fever virus RNAs. Genes Dev, 1998. 12(1): p. 67-83. 121. Simons, J.N., S.M. Desai, D.E. Schultz, S.M. Lemon, and I.K. Mushahwar, Translation initiation in GB viruses A and C: evidence for internal ribosome entry and implications for genome organization. J Virol, 1996. 70(9): p. 6126-35. 122. Isken, O., C.W. Grassmann, H. Yu, and S.E. Behrens, Complex signals in the genomic 3' nontranslated region of bovine viral diarrhea virus coordinate translation and replication of the viral RNA. Rna, 2004. 10(10): p. 1637-52. 123. Mandl, C.W., H. Holzmann, T. Meixner, S. Rauscher, P.F. Stadler, S.L. Allison, and F.X. Heinz, Spontaneous and engineered deletions in the 3' noncoding region of tick-borne encephalitis virus: construction of highly attenuated mutants of a flavivirus. J Virol, 1998. 72(3): p. 2132-40. 124. Brock, K.V., J.F. Ridpath, and R. Deng, Comparative hybridization and nucleotide sequence information from two noncytopathic isolates of bovine viral diarrhea virus. Vet Microbiol, 1993. 36(1-2): p. 69-82. 125. Deng, R. and K.V. Brock, 5' and 3' untranslated regions of pestivirus genome: primary and secondary structure analyses. Nucleic Acids Res, 1993. 21(8): p. 1949-57. 126. Reimann, I., I. Semmler, and M. Beer, Packaged replicons of bovine viral diarrhea virus are capable of inducing a protective immune response. Virology, 2007. 366(2): p. 377-86. 127. Widjojoatmodjo, M.N., H.G. van Gennip, A. Bouma, P.A. van Rijn, and R.J. Moormann, Classical swine fever virus E(rns) deletion mutants: trans-complementation and potential use as nontransmissible, modified, live-attenuated marker vaccines. J Virol, 2000. 74(7): p. 2973-80. 128. Hausmann, Y., G. Roman-Sosa, H.J. Thiel, and T. Rumenapf, Classical swine fever virus glycoprotein E rns is an endoribonuclease with an unusual base specificity. J Virol, 2004. 78(10): p. 5507-12. 129. Hulst, M.M., G. Himes, E. Newbigin, and R.J. Moormann, Glycoprotein E2 of classical swine fever virus: expression in insect cells and identification as a ribonuclease. Virology, 1994. 200(2): p. 558-65. 130. Horiuchi, H., K. Yanai, M. Takagi, K. Yano, E. Wakabayashi, A. Sanda, S. Mine, K. Ohgi, and M. Irie, Primary structure of a base non-specific ribonuclease from Rhizopus niveus. J Biochem, 1988. 103(3): p. 408-18. 131. Fetzer, C., B.A. Tews, and G. Meyers, The carboxy-terminal sequence of the pestivirus glycoprotein E(rns) represents an unusual type of membrane anchor. J Virol, 2005. 79(18): p. 11901-13. 132. Tews, B.A. and G. Meyers, The pestivirus glycoprotein Erns is anchored in plane in the membrane via an amphipathic helix. J Biol Chem, 2007. 282(45): p. 32730-41. 133. Xue, W., F. Blecha, and H.C. Minocha, Antigenic variations in bovine viral diarrhea viruses detected by monoclonal antibodies. J Clin Microbiol, 1990. 28(8): p. 1688-93. 134. Garry, R.F. and S. Dash, Proteomics computational analyses suggest that hepatitis C virus E1 and pestivirus E2 envelope glycoproteins are truncated class II fusion proteins. Virology, 2003. 307(2): p. 255-65. 135. Risatti, G.R., M.V. Borca, G.F. Kutish, Z. Lu, L.G. Holinka, R.A. French, E.R. Tulman, and D.L. Rock, The E2 glycoprotein of classical swine fever virus is a virulence determinant in swine. J Virol, 2005. 79(6): p. 3787-96. 136. Hulst, M.M. and R.J. Moormann, Inhibition of pestivirus infection in cell culture by envelope proteins E(rns) and E2 of classical swine fever virus: E(rns) and E2 interact with different receptors. J Gen Virol, 1997. 78 ( Pt 11): p. 2779-87. 137. Tscherne, D.M., M.J. Evans, M.R. Macdonald, and C.M. Rice, Transdominant inhibition of bovine viral diarrhea virus entry. J Virol, 2008. 82(5): p. 2427-36. 138. Warrener, P. and M.S. Collett, Pestivirus NS3 (p80) protein possesses RNA helicase activity. J Virol, 1995. 69(3): p. 1720-6. 139. Tamura, J.K., P. Warrener, and M.S. Collett, RNA-stimulated NTPase activity associated with the p80 protein of the pestivirus bovine viral diarrhea virus. Virology, 1993. 193(1): p. 1-10. 140. Fulton, R.W., J.F. Ridpath, A.W. Confer, J.T. Saliki, L.J. Burge, and M.E. Payton, Bovine viral diarrhoea virus antigenic diversity: impact on disease and vaccination programmes. Biologicals, 2003. 31(2): p. 89-95. 141. Ridpath, J.F., Practical significance of heterogeneity among BVDV strains: impact of biotype and genotype on U.S. control programs. Prev Vet Med, 2005. 72(1-2): p. 17-30; discussion 215-9. 142. Bolin, S.R. and J.F. Ridpath, Prevalence of bovine viral diarrhea virus genotypes and antibody against those viral genotypes in fetal bovine serum. J Vet Diagn Invest, 1998. 10(2): p. 135-9. 143. Flores, E.F., J.F. Ridpath, R. Weiblen, F.S. Vogel, and L.H. Gil, Phylogenetic analysis of Brazilian bovine viral diarrhea virus type 2 (BVDV-2) isolates: evidence for a subgenotype within BVDV-2. Virus Res, 2002. 87(1): p. 51-60. 144. Kabongo, N., C. Baule, and M. Van Vuuren, Molecular analysis of bovine viral diarrhoea virus isolates from South Africa. Onderstepoort J Vet Res, 2003. 70(4): p. 273-9. 145. Kabongo, N. and M. Van Vuuren, Detection of bovine viral diarrhoea virus in specimens from cattle in South Africa and possible association with clinical disease. J S Afr Vet Assoc, 2004. 75(2): p. 90-3. 146. Becker, Y., Evolution of viruses by acquisition of cellular RNA or DNA nucleotide sequences and genes: an introduction. Virus Genes, 2000. 21(1-2): p. 7-12. 147. Hietala, S.K.a.C., B. M.. , Virus replication. In: Goyal, S.; Ridpath, J. (Eds). Bovine Viral Diarrhea Virus: Diagnosis, Management and Control. Iowa, USA. . Blackwell Publishing. 2005. pp 81-89. 148. Zhang, G., H. Flick-Smith, and J.W. McCauley, Differences in membrane association and sub-cellular distribution between NS2-3 and NS3 of bovine viral diarrhoea virus. Virus Res, 2003. 97(2): p. 89-102. 149. Branza-Nichita, N., D. Durantel, S. Carrouee-Durantel, R.A. Dwek, and N. Zitzmann, Antiviral effect of N-butyldeoxynojirimycin against bovine viral diarrhea virus correlates with misfolding of E2 envelope proteins and impairment of their association into E1-E2 heterodimers. J Virol, 2001. 75(8): p. 3527-36. 150. Grummer, B., M. Beer, E. Liebler-Tenorio, and I. Greiser-Wilke, Localization of viral proteins in cells infected with bovine viral diarrhoea virus. J Gen Virol, 2001. 82(Pt 11): p. 2597-605. 151. Gong, Y., R. Trowbridge, T.B. Macnaughton, E.G. Westaway, A.D. Shannon, and E.J. Gowans, Characterization of RNA synthesis during a one-step growth curve and of the replication mechanism of bovine viral diarrhoea virus. J Gen Virol, 1996. 77 ( Pt 11): p. 2729-36. 152. Wentink, G.H., A.C. van Exsel, I. de Goey, and J.A. van Lieshout, Spread of bovine virus diarrhoea virus in a herd of heifer calves. Vet Q, 1991. 13(4): p. 233-6. 153. Lang-Ree, J.R., T. Vatn, E. Kommisrud, and T. Loken, Transmission of bovine viral diarrhoea virus by rectal examination. Vet Rec, 1994. 135(17): p. 412-3. 154. Mars, M.H., C.J. Bruschke, and J.T. van Oirschot, Airborne transmission of BHV1, BRSV, and BVDV among cattle is possible under experimental conditions. Vet Microbiol, 1999. 66(3): p. 197-207. 155. Niskanen, R., A. Lindberg, and M. Traven, Failure to spread bovine virus diarrhoea virus infection from primarily infected calves despite concurrent infection with bovine coronavirus. Vet J, 2002. 163(3): p. 251-9. 156. Givens, M.D., P.K. Galik, K.P. Riddell, K.V. Brock, and D.A. Stringfellow, Replication and persistence of different strains of bovine viral diarrhea virus in an in vitro embryo production system. Theriogenology, 2000. 54(7): p. 1093-107. 157. Kirkland, P.D., M.R. McGowan, S.G. Mackintosh, and A. Moyle, Insemination of cattle with semen from a bull transiently infected with pestivirus. Vet Rec, 1997. 140(5): p. 124-7. 158. Lindberg, A., R. Niskanen, H. Gustafsson, B. Bengtsson, C. Baule, S. Belak, and S. Alenius, Prenatal diagnosis of persistent bovine viral diarrhoea virus (BVDV) infection by detection of viral RNA in fetal fluids. Vet J, 2002. 164(2): p. 151-5. 159. Stringfellow, D.A. and M.D. Givens, Infectious agents in bovine embryo production: hazards and solutions. Theriogenology, 2000. 53(1): p. 85-94. 160. Durham, P.J. and L.E. Hassard, Prevalence of antibodies to infectious bovine rhinotracheitis, parainfluenza 3, bovine respiratory syncytial, and bovine viral diarrhea viruses in cattle in Saskatchewan and Alberta. Can Vet J, 1990. 31(12): p. 815-20. 161. Nishimori, T., S. Yamada, and M. Shimizu, Production of monoclonal antibodies against classical swine fever virus and their use for antigenic characterization of Japanese isolates. J Vet Med Sci, 1996. 58(7): p. 707-10. 162. Moerman, A., P.J. Straver, M.C. de Jong, J. Quak, T. Baanvinger, and J.T. van Oirschot, A long term epidemiological study of bovine viral diarrhoea infections in a large herd of dairy cattle. Vet Rec, 1993. 132(25): p. 622-6. 163. Zhidkov, S.A. and Y.A. Khalenev, Bovine virus diarrhoea-mucosal disease: prevalence, epizootiology and control measures in the USSR. Rev Sci Tech, 1990. 9(1): p. 173-9. 164. Rweyemamu, M.M., A.A. Fernandez, A.M. Espinosa, A.A. Schudel, I.A. Lager, and S.B. Mueller, Incidence, epidemiology and control of bovine virus diarrhoea virus in South America. Rev Sci Tech, 1990. 9(1): p. 207-21. 165. Bitsch, V. and L. Ronsholt, Control of bovine viral diarrhea virus infection without vaccines. Vet Clin North Am Food Anim Pract, 1995. 11(3): p. 627-40. 166. Graham, D.A., V. Calvert, A. German, and S.J. McCullough, Pestiviral infections in sheep and pigs in Northern Ireland. Vet Rec, 2001. 148(3): p. 69-72. 167. Mainar-Jaime, R.C., B. Berzal-Herranz, P. Arias, and F.A. Rojo-Vazquez, Epidemiological pattern and risk factors associated with bovine viral-diarrhoea virus (BVDV) infection in a non-vaccinated dairy-cattle population from the Asturias region of Spain. Prev Vet Med, 2001. 52(1): p. 63-73. 168. Nuotio, L., M. Juvonen, E. Neuvonen, L. Sihvonen, and J. Husu-Kallio, Prevalence and geographic distribution of bovine viral diarrhoea (BVD) infection in Finland 1993-1997. Vet Microbiol, 1999. 64(2-3): p. 231-5. 169. Paton, D.J., K.H. Christiansen, S. Alenius, M.P. Cranwell, G.C. Pritchard, and T.W. Drew, Prevalence of antibodies to bovine virus diarrhoea virus and other viruses in bulk tank milk in England and Wales. Vet Rec, 1998. 142(15): p. 385-91. 170. Rossmanith, W. and M. Deinhofer, [The occurrence of BVD virus infections in lower Austrian dairy farms]. Dtsch Tierarztl Wochenschr, 1998. 105(9): p. 346-9. 171. Graham, D.A., A. German, I.E. McLaren, and D.A. Fitzpatrick, Testing of bulk tank milk from Northern Ireland dairy herds for viral RNA and antibody to bovine viral diarrhoea virus. Vet Rec, 2001. 149(9): p. 261-5. 172. Alban, L., H. Stryhn, A.M. Kjeldsen, A.K. Ersboll, F. Skjoth, J. Christensen, V. Bitsch, M. Chriel, and U. Stroger, Estimating transfer of bovine virus-diarrhoea virus in Danish cattle by use of register data. Prev Vet Med, 2001. 52(2): p. 133-46. 173. Valle, P.S., Martin, S. W. & Skjerve, E., A hierarchical trend model for bovine virus diarrhoea virus (BVDV) sero-conversion in Norwegian dairy herds from 1993 through 1997. Prev Vet Med, 2000. 47: p. 39-52. 174. Reinhardt G., S.R., H. Fiedler, M. Niedda, M. Aguilar, V. Cubillos, E. Paredes, Diarrea viral bovina- enfermedad mucosa. Primer aislamiento del agente causal en Chile. Arch. Med. Vet., 1986. 18: p. 157-161. 175. Fiedler H, V.C., E Paredes, G Reinhardt, S Riedemann, M Niedda, M Aguilar, Enfermedad mucosa/ diarrea viral bovina. Hallazgos anatomopatológicos de los primeros casos en Chile. Arch Med Vet 1986. 18: p. 151-155. 176. Reinhardt, G., S. Riedemann, S. Ernst, M. Aguilar, V. Cubillos, E. Paredes, Seroprevalence of bovine viral diarrhoea- mucosal disease in southern Chile. Prev Vet Med, 1990. 10: p. 73-78. 177. Celedón, M., Vargas, C., Salinas A., Casanova A.,Ibarra L.,Berrios P., Prevalencias serológicas para el virus de la diarrea viral bovina y rinotraqueitis infecciosa bovina en predios lecheros de la Región Metropolitana de Chile. Av Cs Vet, 1996. 11: p. 75-82. 178. Celedón, M., L. Palacios, J. Pizarro, L. Ibarra, Prevalencia de anticuerpos seroneutralizantes para el virus diarrea viral bovina, en ganado de carne de la Región Metropolitana, Chile. Av Cs Vet, 1997. 12: p. 98-100. 179. Celedón, M., J. Carbonell, L. Ibarra, J. Pizarro, Detección de bovinos portadores inmunotolerantes al virus de la diarrea viral bovina en predios lecheros de la Región Metrolpolitana. Chile. Arch Med Vet, 1998. 30: p. 125-132. 180. Aguilera, P.M., Caracterización genotípica de aislados nacionales del VDVB mediante enzimas de restricción., Tesis de grado para la obtención del titulo de médico Veterinario, in Fac. Cs. Vet. y Pec. 2001, U de Chile: Stgo. p. 59. 181. Montt, J.M., Caraterización biológica de aislados nacionales del virus diarrea viral bovina pertenecientes a los genogrupos I y II, in Fac Cs Vet y Pec. 2004, U de Chile: Stgo. p. 65. 182. Armitage, P., Statistical Methods in Medical Research. Blackwell Scientific Publications. Oxford UK, 1980: p. p.279-301. 183. Mijnes, J.D., B.C. Lutters, A.C. Vlot, E. van Anken, M.C. Horzinek, P.J. Rottier, and R.J. de Groot, Structure-function analysis of the gE-gI complex of feline herpesvirus: mapping of gI domains required for gE-gI interaction, intracellular transport, and cell-to-cell spread. J Virol, 1997. 71(11): p. 8397-404. 184. Larkin, M.A., G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, F. Valentin, I.M. Wallace, A. Wilm, R. Lopez, J.D. Thompson, T.J. Gibson, and D.G. Higgins, Clustal W and Clustal X version 2.0. Bioinformatics, 2007. 23(21): p. 2947-8. 185. Mishra, N., R. Dubey, K. Rajukumar, C. Tosh, A. Tiwari, S.S. Pitale, and H.K. Pradhan, Genetic and antigenic characterization of bovine viral diarrhea virus type 2 isolated from Indian goats (Capra hircus). Vet Microbiol, 2007. 124(3-4): p. 340-7. 186. Saitou, N. and M. Nei, The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol, 1987. 4(4): p. 406-25. 187. Kimura, M., A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol, 1980. 16(2): p. 111-20. 188. Meyers, G., A. Ege, C. Fetzer, M. von Freyburg, K. Elbers, V. Carr, H. Prentice, B. Charleston, and E.M. Schurmann, Bovine viral diarrhea virus: prevention of persistent fetal infection by a combination of two mutations affecting Erns RNase and Npro protease. J Virol, 2007. 81(7): p. 3327-38. 189. Meyers, G., A. Saalmuller, and M. Buttner, Mutations abrogating the RNase activity in glycoprotein E(rns) of the pestivirus classical swine fever virus lead to virus attenuation. J Virol, 1999. 73(12): p. 10224-35. 190. von Freyburg, M., A. Ege, A. Saalmuller, and G. Meyers, Comparison of the effects of RNase-negative and wild-type classical swine fever virus on peripheral blood cells of infected pigs. J Gen Virol, 2004. 85(Pt 7): p. 1899-908. 191. Langedijk, J.P., P.A. van Veelen, W.M. Schaaper, A.H. de Ru, R.H. Meloen, and M.M. Hulst, A structural model of pestivirus E(rns) based on disulfide bond connectivity and homology modeling reveals an extremely rare vicinal disulfide. J Virol, 2002. 76(20): p. 10383-92. 192. Buckwold, V.E., B.E. Beer, and R.O. Donis, Bovine viral diarrhea virus as a surrogate model of hepatitis C virus for the evaluation of antiviral agents. Antiviral Res, 2003. 60(1): p. 1-15. 193. Moulin, H.R., T. Seuberlich, O. Bauhofer, L.C. Bennett, J.D. Tratschin, M.A. Hofmann, and N. Ruggli, Nonstructural proteins NS2-3 and NS4A of classical swine fever virus: essential features for infectious particle formation. Virology, 2007. 365(2): p. 376-89. 194. Jones, L.R., R. Zandomeni, and E.L. Weber, Genetic typing of bovine viral diarrhea virus isolates from Argentina. Vet Microbiol, 2001. 81(4): p. 367-75. 195. Quetalpillan, J., "Determinación de eficiencia replicativa de aislados chilenos de llamas y alpacas de Virus Diarrea Viral Bovina en células MDBK" Memoria de Titulo para optar al título de Medico Veterinario Fac. Cs. Vet. U de chile, 2012: p. p 80. 196. Aguirre, I.M., “Caracterización genotípica de pestivirus aislados de camélidos sudamericanos en Chile” Doctorado en Cs. SAP y V 2009. 197. Thurner, C., C. Witwer, I.L. Hofacker, and P.F. Stadler, Conserved RNA secondary structures in Flaviviridae genomes. J Gen Virol, 2004. 85(Pt 5): p. 1113-24. 198. Chon, S.K., D.R. Perez, and R.O. Donis, Genetic analysis of the internal ribosome entry segment of bovine viral diarrhea virus. Virology, 1998. 251(2): p. 370-82. 199. Fletcher, S.P. and R.J. Jackson, Pestivirus internal ribosome entry site (IRES) structure and function: elements in the 5' untranslated region important for IRES function. J Virol, 2002. 76(10): p. 5024-33. 200. Yu, H., C.W. Grassmann, and S.E. Behrens, Sequence and structural elements at the 3' terminus of bovine viral diarrhea virus genomic RNA: functional role during RNA replication. J Virol, 1999. 73(5): p. 3638-48. 201. Pankraz, A., H.J. Thiel, and P. Becher, Essential and nonessential elements in the 3' nontranslated region of Bovine viral diarrhea virus. J Virol, 2005. 79(14): p. 9119-27. 202. Lackner, T., A. Muller, M. Konig, H.J. Thiel, and N. Tautz, Persistence of bovine viral diarrhea virus is determined by a cellular cofactor of a viral autoprotease. J Virol, 2005. 79(15): p. 9746-55. 203. Sainz, I.F., L.G. Holinka, Z. Lu, G.R. Risatti, and M.V. Borca, Removal of a N-linked glycosylation site of classical swine fever virus strain Brescia Erns glycoprotein affects virulence in swine. Virology, 2008. 370(1): p. 122-9. 204. Tews, B.A., E.M. Schurmann, and G. Meyers, Mutation of cysteine 171 of pestivirus E rns RNase prevents homodimer formation and leads to attenuation of classical swine fever virus. J Virol, 2009. 83(10): p. 4823-34. 205. Xia, H., L. Liu, N. Wahlberg, C. Baule, and S. Belak, Molecular phylogenetic analysis of bovine viral diarrhoea virus: a Bayesian approach. Virus Res, 2007. 130(1-2): p. 53-62. 206. Kummerer, B.M., D. Stoll, and G. Meyers, Bovine viral diarrhea virus strain Oregon: a novel mechanism for processing of NS2-3 based on point mutations. J Virol, 1998. 72(5): p. 4127-38. 207. Ciulli, S., E. Galletti, M. Battilani, V. Galligioni, and S. Prosperi, Analysis of variability and antigenic peptide prediction of E2 BVDV glycoprotein in a mucosal-disease affected animal. Vet Res Commun, 2009. 33 Suppl 1: p. 125-7. 208. van Rijn, P.A., A common neutralizing epitope on envelope glycoprotein E2 of different pestiviruses: implications for improvement of vaccines and diagnostics for classical swine fever (CSF)? Vet Microbiol, 2007. 125(1-2): p. 150-6. 209. Lin, M., F. Lin, M. Mallory, and A. Clavijo, Deletions of structural glycoprotein E2 of classical swine fever virus strain alfort/187 resolve a linear epitope of monoclonal antibody WH303 and the minimal N-terminal domain essential for binding immunoglobulin G antibodies of a pig hyperimmune serum. J Virol, 2000. 74(24): p. 11619-25. 210. Larsen, R., T.P. Rokenes, and B. Robertsen, Inhibition of infectious pancreatic necrosis virus replication by atlantic salmon Mx1 protein. J Virol, 2004. 78(15): p. 7938-44. 211. Neumann, G., T. Noda, and Y. Kawaoka, Emergence and pandemic potential of swine-origin H1N1 influenza virus. Nature, 2009. 459(7249): p. 931-9. 212. Vaz da Costa, A., Elsner W., Tavares B. , Serprevalence and risk factors to the infectious by bovine herpesvirus type 1 (BHV-1) in Goiás State, Brazil. Cienc. Rural, 2005(35 (6)).

No hay comentarios:

Publicar un comentario en la entrada