martes, 26 de abril de 2016

DIAGNÓSTICO MOLECULAR DEL VIRUS DISTEMPER CANINO MEDIANTE PCR Cynthia A. Muñoz C. 2013

DIAGNÓSTICO MOLECULAR DEL VIRUS DISTEMPER CANINO
MEDIANTE LA REACCIÓN EN CADENA DE LA POLIMERASA
ASOCIADA A TRANSCRIPCIÓN INVERSA DEL GEN DE LA
PROTEÍNA DE LA NUCLEOCÁPSIDE VIRAL

MOLECULAR DIAGNOSIS OF CANINE DISTEMPER VIRUS BY
REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION
OF THE VIRAL NUCLEOCAPSID PROTEIN GENE

Cynthia Adriana Muñoz Cordero

RESUMEN
El Distemper Canino es una enfermedad viral de distribución mundial, letal y altamente
contagiosa, producida por el Virus Distemper Canino, el cual afecta a un amplio rango de
hospederos, como perros domésticos y representantes silvestres de distintas familias de
carnívoros, comprometiendo drásticamente la conservación de especies amenazadas.
Para el diagnóstico definitivo ante-mortem de la enfermedad, se han sugerido una gran
variedad de parámetros clínicos y diferentes tipos de ensayos, sin embargo, debido al curso
imprevisible y variable de ésta, el diagnóstico final para algunos animales continúa siendo
incierto.
En consideración a lo anterior y a que el desarrollo de técnicas moleculares ofrece diversos
procedimientos para pruebas diagnósticas, el objetivo de esta memoria de título postuló la
detección del gen de la proteína de la nucleocápside del Virus Distemper Canino mediante
la reacción en cadena de la polimerasa asociada a transcripción inversa, como una forma de
diagnóstico rápido y específico para la detección del virus.
La especificidad del método se evidenció por la amplificación del fragmento esperado en el
100% de los controles positivos a Virus Distemper Canino, tanto los tres controles
vacunales (cepa Onderstepoort, Lederle y Snyder Hill), como los diez controles de RNA
viral provenientes desde aislados nacionales, y en la no amplificación del fragmento
esperado en los controles negativos (perros no infectados con y sin vacunación). Sumado a
esto, los fragmentos de DNA amplificados fueron enviados a secuenciar y mediante el
programa BLAST, se confirmó que éstos correspondían a Virus Distemper Canino.
Además, se propone que el método podría tener una alta sensibilidad, debido a la
amplificación del fragmento esperado en el 91% de las muestras de campo provenientes de
perros sospechosos de Distemper Canino.
En base a lo anterior, el método implementado puede colaborar con la prevención y el
control del aumento de Distemper Canino, tanto en la población canina, como en otros
animales susceptibles a la enfermedad.
PALABRAS CLAVE: Virus Distemper Canino, proteína de la nucleocápside, RT-PCR.

ABSTRACT
Canine Distemper is a viral disease of worldwide distribution, lethal and highly contagious,
caused by the Canine Distemper Virus, which affects a wide host range, as domestic dogs
and wild representatives of different families of carnivores, compromising drastically the
conservation of threatened species.
For the definitive diagnosis of the ante-mortem disease, have been suggested a variety of
clinical parameters and different types of assays, however, due to unpredictable and
variable course of this, the final diagnosis for some animals remains uncertain.
In consideration to the foregoing and to the recent development of molecular techniques
provides various methods for diagnostic tests, the objective of this memory postulated the
detection of the nucleocapsid protein gene of Canine Distemper Virus by reverse
transcriptase-polymerase chain reaction, as a form of rapid and specific diagnosis for the
detection of the virus.
The specificity of the method was demonstrated by amplification of the expected fragment
at 100% of the positive controls to Canine Distemper Virus, both three vaccine controls
(strain Onderstepoort, Lederle and Snyder Hill), as ten controls of viral RNA from national
isolated, and in the not amplification of the expected fragment in the negative controls
(uninfected dogs with and without vaccination). In addition to this, the amplified DNA
fragments were sent to sequence and by means the BLAST program, it was confirmed that
these were corresponding to Canine Distemper Virus.
Additionally, it is proposed that the method could have high sensitivity, due to the
amplification of the expected fragment at 91% of the field samples of dogs suspected of
Canine Distemper.
Based on the above, the method implemented can contribute to the prevention and control
of the increase of Canine Distemper, both in the canine population, as in other animals
susceptible to the disease.
KEYWORDS: Canine Distemper Virus, nucleocapsid protein, RT-PCR.
1
INTRODUCCIÓN
Virus Distemper Canino
El Virus Distemper Canino (VDC) pertenece al género Morbillivirus de la familia
Paramixoviridae, orden Mononegavirales y está relacionado antigénicamente con los virus
de la Peste Bovina y del Sarampión. Es un virus pleomórfico con envoltura lipídica, de un
diámetro de 150 a 300 nm, cuyo genoma es un RNA de hebra simple, de sentido negativo y
con una nucleocápside helicoidal. El genoma consta de alrededor de 15,7 kilobases (kb),
que codifica para seis proteínas estructurales: la proteína de la nucleocápside (N), la
fosfoproteína (P), la proteína de matriz (M), la polimerasa (L) y las glicoproteínas de
envoltura, la proteína de fusión (F) y la hemaglutinina (H). Estas últimas dos, ubicadas en
la envoltura lipídica que rodea el virión, son las encargadas del reconocimiento e ingreso
del virus a la célula del hospedador, siendo los objetivos principales de los anticuerpos
neutralizantes que sintetiza el sistema inmune del mismo (Shin et al., 2004, Sidhu et al.,
1993; Summers y Appel, 1994; Von Messling et al., 2001). La nucleocápside helicoidal,
contiene las proteínas N, P y L, las que inician la replicación intracelular. La proteína M,
conecta las glicoproteínas de la superficie y de la nucleocápside durante la maduración viral
(Beineke et al., 2009; Shin et al., 2004).
El gen N, de alrededor de 1,5 kb, es uno de los genes más conservados del genoma VDC y
su región central es la que presenta la menor variación. Posee regiones muy conservadas en
los primeros 2/3 del gen entre los miembros del género Morbillivirus y codifica la más
abundante de las proteínas virales estructurales, la proteína de la nucleocápside, que posee
funciones reguladoras de la transcripción y replicación, así como la encapsidación del
genoma RNA en una nucleocápside RNAsa resistente. No obstante, a pesar de ser una
región muy conservada del genoma VDC, se han demostrado algunas variaciones del gen N
entre aislados de campo (Castilho et al., 2007; Frisk et al., 1999; Gallo et al., 2007;
Keawcharoen et al., 2005).
El VDC, es un virus envuelto muy sensible al medio ambiente, sin embargo su constante
eliminación a través de todo tipo de secreciones y fluidos corporales a partir del séptimo día
postinfección, y su alta infectividad, permiten su rápida diseminación en el ecosistema.
2
Sumado a esto, existen animales infectados que eliminan el virus antes de manifestar signos
asociados a la virosis
(Summers y Appel, 1994).
Hospederos del Virus Distemper Canino
Los hospederos del VDC incluyen numerosas familias del orden de los carnívoros como
canidae (perros, zorros), Procyonidae (mapaches), Mustelidae (hurones y visones),
Mephitidae (zorrillos), Hyaenidae (hienas), Ursidae (osos), Ailuridae (pandas rojos),
Viverridae (ginetas, civetas) y Felidae (tigres, leones, leopardos, jaguares), presentándose
inclusive en mamíferos marinos como pinnípedos y cetáceos.
El Distemper Canino (DC) se ha observado en grandes felinos, en el Parque Nacional del
Serengeti de Tanzania en 1994, en los zoológicos de América del Norte en 1991 y 1992, en
focas del Lago Baikal y Mar Caspio en 1988 y en pecaríes de collar (Tayassu tajacu) en
Arizona. Asimismo la enfermedad DC se ha presentado en primates no humanos, macaco
japonés (Macaca fuscata) infectado naturalmente por primera vez en 1989 en Japón y en el
2006 en China, en monos Rhesus (Macaca mulatta), donde 10.000 animales fueron
infectados (Appel y Summers, 1999; Castilho et al., 2007; Martella et al., 2008; Summers
y Appel, 1994).
Por otro parte, una posible relación entre enfermedad de Paget en los humanos (osteítis
deformante) e infección por VDC ha sido demostrada, debido al descubrimiento de RNA
del virus en tejidos afectados (Frisk et al., 1999; Mee et al., 1998).
En Chile, en el año 1994 se informó del primer aislamiento del virus en cultivos celulares
inoculados con secreciones de un canino con signos clínicos de DC. El diagnóstico clínico
se confirmó por microscopía electrónica y estudios histopatológicos (Cerda et al., 1994).
En el año 2003 ocurrió un brote de DC en las poblaciones de zorros endémicos del Parque
Nacional Fray Jorge (Región de Coquimbo), el cual se especuló que podría estar
relacionado con la existencia de mustélidos nativos como el chingue y el quique (Moreira y
Stutzin, 2005). Además en el 2007, hubo un brote de DC en la isla Robinson Crusoe
(Región de Valparaíso), donde fueron afectados varios perros domésticos, pero no los
lobos marinos endémicos de la isla (Jara et al., 2007).
3
Patogenia del Virus Distemper Canino
La naturaleza de la enfermedad es variable y su curso depende en gran medida de las
interacciones entre el virus y el sistema inmune del hospedero. Si bien todos los perros son
susceptibles al VDC, principalmente son afectados los cachorros de tres a seis meses de
edad, ya que han perdido los anticuerpos maternales y su sistema inmune tiene una menor
eficiencia (Martella et al., 2008, Summers y Appel, 1994).
El virus entra en el hospedero por vía ocular, nasal u oral, y rápidamente se inicia la
replicación en nódulos linfáticos locales y en siete días a todos los tejidos linfáticos
(viremia primaria), produciendo la infección temprana de linfocitos y células
mononucleares, por medio del bloqueo de la síntesis y de las vías de señalización de
interferones y citoquinas, disminuyendo la proliferación de linfocitos B y T, siendo más
afectados estos últimos, lo que resulta en una grave inmunosupresión del hospedero (Von
Messling et al., 2001). Durante la segunda y tercera semana post infección, algunos perros
inician una fuerte respuesta inmune humoral y celular y pueden recuperarse sin signos
clínicos posteriores, mientras otros desarrollan una débil respuesta inmune y presentan la
enfermedad aguda o subaguda, debido a que los linfocitos y células mononucleares
infectadas transportan el virus a la superficie epitelial del tracto digestivo, respiratorio,
urogenital, piel y/o al sistema nervioso central, con los signos clínicos respectivos (viremia
secundaria) (Appel y Summers, 1999).
Signos clínicos de la enfermedad
Los signos pueden ser variables, desde leves a severos, con o sin compromiso del sistema
nervioso central y con alrededor de un 50% de mortalidad (Appel y Summers, 1999).
Días después de la viremia primaria, generalmente aparecen signos como secreción nasal y
ocular, conjuntivitis y anorexia (Martella et al., 2008), y luego de la viremia secundaria, se
pueden presentar signos como secreción nasal, tos, neumonía, diarrea, vómitos, pústulas
dérmicas, entre otros, los que generalmente aparecen aumentados por la infección
bacteriana secundaria. La localización en el sistema nervioso central, dependiendo de la
cepa viral, genera la enfermedad aguda con mioclonía, hiperestesia y depresión, o la
enfermedad subaguda con incoordinación, paresia, parálisis y temblores musculares (Appel
y Summers, 1999).
4
Vacunas
Las vacunas utilizadas en su mayoría corresponden a vacunas polivalentes de virus
atenuados, las cuales confieren una limitada protección a los individuos y además tienen el
riesgo de provocar la enfermedad en los mismos, ya que mantienen su linfotropismo y
capacidad de inducir inmunosupresión, sobretodo en animales inmunodeprimidos o
menores de 6 meses (Keawcharoen et al., 2005; Martella et al., 2008).
Otras alternativas que presentan una mayor seguridad que las anteriores, son las vacunas
recombinantes, que prescinden del patógeno y utilizan algunos de sus antígenos para
estimular adecuadamente al sistema inmune del hospedero. Estas vacunas muestran una
gran eficacia, con una producción de anticuerpos de mayor afinidad y duración que las
vacunas de virus atenuados (Larson y Schultz, 2006).
Considerando que los cachorros no son inmunocompetentes antes de las ocho semanas de
vida y que los anticuerpos maternos duran en el recién nacido aproximadamente entre ocho
y diez semanas, se recomienda vacunar a las seis semanas de edad y para superar la posible
interferencia de los anticuerpos maternos, se debe repetir la vacunación cada 3 semanas
hasta las 12 semanas (2 dosis más), debiendo repetir una vacunación anualmente (Berríos y
Durán, 2005).
Diagnóstico de VDC
De los métodos diagnósticos, la signología clínica es la principal herramienta utilizada por
médicos veterinarios, no obstante, la inespecificidad de los signos en algunos casos
imposibilita llegar a un diagnóstico final, por lo que es necesaria la utilización de pruebas
de laboratorio. Entre ellas, una de las más utilizadas es el ELISA (Enzyme-Linked Immuno
Sorbent Assay), que puede detectar anticuerpos séricos (Acs) IgM (contra las proteínas de
la nucleocápside, N y P del VDC) o IgG (contra los antígenos de la envoltura, H y F del
VDC). Sin embargo esta prueba no diferencia si los Acs producidos corresponden a Acs
maternos, vacunales o por infección. Por lo demás la producción de Acs depende de la
etapa de la enfermedad, pudiendo no encontrarse en fases iniciales y finales de ésta. En
perros no vacunados con infección aguda, éstos pueden morir sin presentar Acs contra el
virus. En animales con signos neurológicos, la determinación de Acs específicos contra
VDC en líquido cefalorraquídeo no contaminado con sangre, es diagnóstico definitivo de
5
encefalitis por DC, sin embargo éste es un método muy invasivo y sus resultados son
variables (Appel y Summers, 1999; Frisk et al., 1999).
Otro método diagnóstico utilizado es la detección de cuerpos de inclusión
intracitoplasmáticos eosinofílicos por citología o por inmunofluorescencia, no obstante,
éstos sólo se pueden visualizar en ciertos periodos de la enfermedad, generalmente estando
ausentes cuando se generan los signos clínicos (Martella et al., 2008; Summers y Appel,
1994). La inmunohistoquímica se utiliza para detectar antígenos virales y/o cuerpos de
inclusión en tejidos, con resultados confiables sólo cuando existe una marcada viremia,
además esta técnica se puede realizar exclusivamente en muestras tomadas post‐mortem
(Frisk et al., 1999; Keawcharoen et al., 2005). El aislamiento del virus, tiene una
sensibilidad y especificidad muy alta, no obstante es un procedimiento laborioso y muy
lento, por lo que no es utilizado rutinariamente para el diagnóstico (Martella et al., 2008).
La reacción en cadena de la polimerasa asociada a transcripción inversa (RT-PCR),
consiste en una amplificación exponencial de fragmentos de DNA del virus, previa
transcripción inversa desde RNA a DNA complementario, permitiendo detectar la
presencia del RNA del virus tempranamente, siendo a diferencia de las otras técnicas
mencionadas, una prueba sensible, específica y rápida para el diagnóstico de VDC, y puede
resultar positiva aún cuando otras pruebas no logran detectar al virus (Appel y Summers,
1999; Frisk et al., 1999; Martella et al., 2008).
En las últimas décadas, se han desarrollado diversos métodos basados en la RT-PCR para el
diagnóstico de VDC, siendo los principales blancos para la amplificación, regiones
genómicas que presentan un alto grado de conservación entre los aislamientos del virus. Es
así, como en 1999 Frisk et al. desarrollaron un método, basado en la amplificación por RTPCR
de un fragmento conservado de 287 pb del gen N del VDC, el cual fue utilizado
posteriormente por diversos autores, demostrando ser un técnica muy eficaz para la
detección del genoma del virus (Calderón et al., 2007; Frisk et al., 1999; Gallo et al.,
2007).
Esta memoria de título tiene como objetivo principal diagnosticar molecularmente el VDC,
a través de la implementación del ensayo de la RT-PCR del gen de la proteína de la
nucleocápside.
6
MATERIAL Y MÉTODOS
El trabajo fue realizado en los laboratorios de Virología y Microbiología del Departamento
de Medicina Preventiva Animal de la Facultad de Ciencias Veterinarias y Pecuarias de la
Universidad de Chile, con financiamiento del PROYECTO FIV 121014019102010.
1.- Controles.
Controles positivos. Una vez establecido el protocolo de la RT-PCR, se probó el
funcionamiento del método con controles positivos provenientes de vacunas y desde
aislados nacionales del virus.
Para los controles positivos vacunales, se utilizó sangre del control negativo sin
vacunación, contaminada con virus vivos atenuados del VDC obtenidos desde las vacunas
“Nobivac® Puppy DP” (cepa Onderstepoort), “Canigen MHA2PPi/L” (cepa Lederle) y
“Vanguard Plus 5/CV-L” (cepa Snyder Hill). Para esto cada vacuna fue reconstituida con
0,5 mL de cloruro de sodio 0.9%, y luego esta mezcla fue agregada a 0,5 ml de sangre, para
posteriormente extraer el RNA.
Los diez controles positivos provenientes de aislados nacionales del virus, correspondieron
a RNA viral que se encontraba guardado en el laboratorio de Virología Animal de FAVET,
a -20 °C por más de un año. Estos aislados provenían de perros domésticos de Santiago de
Chile y fueron confirmados como positivos por una RT-PCR previa basada en el gen de la
hemaglutinina (Jara, 2011; Salas, 2013).
Controles negativos. Se utilizó sangre con anticoagulante de dos animales no infectados,
de un perro adulto sin signos clínicos de la enfermedad, sin antecedentes de riesgo y sin
vacunación y de un perro adulto sin signos clínicos de la enfermedad y sin antecedentes de
riesgo, pero con calendario de vacunación al día (vacunado por última vez hace diez
meses).
2.- Muestras sospechosas de DC
Una vez confirmado el funcionamiento del método con los controles, éste fue probado con
muestras de campo nacionales, donde se analizaron once muestras de sangre periférica con
anticoagulante (2 mL), provenientes de perros que presentaron signos nerviosos
compatibles con DC y que en algunos casos se presentaron positivos a la prueba de ELISA
7
específica para VDC, con títulos de anticuerpos IgM ≥1:80. Estas muestras fueron
recolectadas de clínicas veterinarias de Santiago de Chile, mantenidas en refrigeración a 4
°C y procesadas en un tiempo menor a dos semanas. Además fueron clasificadas según:
raza, sexo, edad, estado de vacunación contra VDC y títulos de anticuerpos IgM anti-VDC
(Cuadro 1).
Canino N° Raza Sexo Edad
Vacunación
contra VDC
Títulos
IgM
1 Poodle Macho 6 años - -
2 Mestizo Hembra 2 años Sí 1:40
3 Mestizo Macho 11 meses No 1:80
4 Bull Terrier Hembra 2 años Sí 1:80
5 Mestizo Hembra 1 año Si 1:80
6 Mestizo Hembra 3 años No 1:40
7 Mestizo Macho 3,5 años No -
8 Bóxer Macho 2 años - 1:40
9 Mestizo Hembra 9 meses No 1:80
10 Mestizo Hembra 1,5 años No 1:20
11 Mestizo Macho 1 año Sí 1:80
Cuadro 1: Clasificación de muestras de sangre periférica provenientes de perros con signos nerviosos
sospechosos de DC, según: raza, sexo, edad, estado de vacunación contra VDC y títulos de anticuerpos
IgM anti-VDC.
3.- Obtención de la capa flogística desde las muestras de sangre sospechosas
En las muestras de sangre con anticoagulante, de los controles negativos y de los animales
sospechosos de DC, se utilizó la preparación “Histopaque®-1077” de Sigma-Aldrich®
según instrucción del fabricante, para el aislamiento de linfocitos y otras células
mononucleares, que son el blanco de la infección por VDC, por lo que se obtuvo una mayor
concentración de RNA viral en las muestras donde se encontraba el virus. Para esto, se
colocaron 2 mL de Histopaque®-1077 en tubos de centrífuga, agregándoles sobre esta
solución, 2 mL de sangre con anticoagulante, para luego centrifugar a 400xg durante 30
minutos a temperatura ambiente. Después se transfirió con cuidado la banda mononuclear
(interfaz opaca) con una pipeta de Pasteur, a un tubo de centrífuga limpio, se lavó con 10
mL de solución salina, se agitó y centrifugó a 250xg durante 10 minutos, para luego aspirar
8
el sobrenadante y desecharlo. Finalmente, las células mononucleares se resuspendieron en
Trizol y se procedió a extraer el RNA.
4.- Extracción de RNA viral mediante kit “Trizol LS” de Invitrogen®
Para la extracción del RNA total de la muestra, se agregaron 750 μL de reactivo Trizol a las
células sanguíneas mononucleares, obtenidas según se describió anteriormente y a 250 μL
de los controles positivos vacunales (sangre contaminada con vacuna), incubando durante
cinco minutos a temperatura ambiente. Luego, a cada tubo se le agregaron 200 μL de
cloroformo, se mezclaron enérgicamente por quince segundos y se incubaron a temperatura
ambiente por cinco minutos. Enseguida, se centrifugaron a 7000xg por quince minutos y se
transfirió la fase acuosa a un tubo limpio. Para la precipitación del RNA, se agregaron 0.5
mL de isopropanol, se dejaron diez minutos a temperatura ambiente, se centrifugaron a
7000xg durante diez minutos, se eliminó el sobrenadante, se lavaron tres veces con etanol
75% (1 mL), se agitaron quince segundos en vortex y sé centrifugaron a 2000xg durante
cinco minutos. Para la resuspensión del RNA se eliminó el sobrenadante, se secó el
precipitado de RNA al vacío durante cinco minutos y se resuspendió en 100 μL de agua
libre de nucleasas. Para finalizar, el RNA fue incubado a 55-60 °C por diez minutos y
mantenido a -20 °C para su uso posterior.
5.- RT-PCR
Se utilizó un termociclador Apollo (CLP, USA) de 96 pocillos de 0,2 mL y un protocolo
con temperaturas, tiempos y ciclos adecuados para cada etapa.
Partidores. Los partidores para el RT-PCR fueron enviados a sintetizar a la empresa
Bioscan®, siendo sus secuencias localizadas en una región muy conservada del gen de la
nucleocápside, y correspondieron a P1: 5’ - ACAGGATTGCTGAGGACCTAT - 3’
(nucleótido 769 - 789) y a P2: 5’ - CAAGATAACCATGTACGGTGC - 3’ (nucleótido
1055 - 1035). Estos partidores permitieron amplificar un fragmento de DNA de alrededor
de 290 pares de bases (pb) (6).
Reacción RT-PCR. Ésta se realizó utilizando el kit “SuperScript™ one step RT-PCR with
platinum Taq” (Invitrogen®) según instrucción del fabricante. La reacción en el
termociclador comenzó con la síntesis de DNA complementario y una predesnaturalización
realizada en un ciclo (45 °C durante treinta minutos y luego dos minutos
9
a 94 °C). Después se llevó a cabo la amplificación por PCR en cuarenta ciclos, la que
consistió en una desnaturalización (94 °C durante un minuto), alineación de los partidores
(60 °C por dos minutos), elongación (72 °C por dos minutos), y una extensión final en un
ciclo (72 °C durante diez minutos) (6).
6.- Detección del fragmento de DNA sintetizado en la RT-PCR
Los productos del RT-PCR fueron analizados por medio de electroforesis en gel agarosa
2% en tampón Tris-HC1 (100 mM Tris-HC1, 10 mM EDTA) y comparación de recorrido
frente a un estándar de tamaño molecular: Hyperladder IV (Bioline®). El producto del PCR
se mezcló con un producto comercial de carga (Fermentas®) y a continuación se realizó la
electroforesis a 90 V por cuarenta y cinco minutos. Después de la electroforesis el gel fue
incubado con bromuro de etidio (0,5 μg/mL) durante treinta minutos, luego fue visualizado
en un transiluminador de luz ultravioleta y posteriormente fue fotografiado.
7.- Secuenciación de fragmentos amplificados
Los fragmentos de DNA obtenidos desde dos muestras positivas se enviaron a secuenciar,
al Centro de Secuenciación de Genytec Ltda.
8.- Análisis bioinformático de las secuencias nucleotídicas de los fragmentos de DNA
Las secuencias obtenidas fueron alineadas utilizando el programa online gratuito ClustalW
2.1 (http://www.ebi.ac.uk/Tools/msa/clustalw2/), obteniendo una secuencia de consenso
para cada muestra utilizada. Además, las secuencias consenso fueron ingresadas al
programa informático de alineamiento de secuencias BLAST 2.2.28
(http://blast.ncbi.nlm.nih.gov/), para identificar el origen de los fragmentos de DNA
obtenidos en la RT-PCR.
9.- Análisis de resultados
Se consideraron positivas aquellas muestras que luego del RT-PCR sintetizaron un
fragmento de DNA de aproximadamente 290 pb y que luego del análisis con el programa
BLAST su identidad nucleotídica correspondió a VDC.

10
RESULTADOS

Implementación del ensayo RT-PCR del gen de la proteína de la nucleocápside del
VDC
Una vez establecido el protocolo de la RT-PCR del gen de la proteína de la nucleocápside
del VDC, se procedió a probar el funcionamiento del método con los controles positivos y
negativos, para posteriormente analizar las muestras de campo sospechosas de DC.
a.- Controles.
Se procesaron tres controles positivos provenientes de vacunas comerciales, diez controles
positivos correspondientes a RNA del VDC (aislados nacionales) y dos controles negativos
procedentes de perros no infectados. Todos estos controles fueron sometidos a la RT-PCR
del gen de la nucleocápside del VDC y luego de la visualización de los productos, todos los
controles positivos generaron bandas intensas de alrededor de 290 pb y en el caso de los
controles negativos, éstos no presentaron bandas visibles (Figura 1).
Figura 1: Visualización productos amplificados por RT-PCR mediante electroforesis en gel de
agarosa al 2% y posterior incubación en bromuro de etidio. Los carriles 1 y 2 corresponden a los
controles negativos, perro no infectado vacunado y sin vacunación respectivamente. Los carriles 3,
4 y 5 corresponden a los controles positivos vacunales, sangre de control negativo sin vacunación
contaminada con vacuna cepa Onderstepoort, Lederle y Snyder Hill respectivamente. Los carriles 6
y 16 corresponden al marcador de tamaño molecular (100 - 1000 pb). Los carriles 7, 8, 9, 11, 12, 13,
14, 15, 17 y 18 corresponden a los controles positivos de RNA viral provenientes de aislados
nacionales a VDC.
11
b.- Muestras sospechosas de DC
Se recolectaron once muestras de sangre periférica de perros con signos nerviosos
concordantes con DC y que en algunos casos se presentaron positivos a la prueba de ELISA
específica para VDC (IgM) (Cuadro 1).
Todas estas muestras fueron sometidas a la RT-PCR del gen de la nucleocápside del VDC y
luego de la visualización de los productos, diez muestras (canino N°1 al N°10, Cuadro 1)
presentaron bandas de alrededor de 290 pb, correspondientes al fragmento de DNA
esperado. Al contrario, la muestra proveniente del canino N°11 no generó bandas visibles
(Figura 2).
Figura 2: Visualización de productos amplificados por RT-PCR mediante electroforesis en gel de
agarosa al 2% y posterior incubación en bromuro de etidio. El carril 1 corresponde al control
positivo vacunal, cepa Onderstepoort. El carril 2 corresponde al control negativo, perro no infectado
sin vacunación. El carril 9 y 16 corresponden al marcador de tamaño molecular (100 - 1000 pb).
Los carriles 3, 4, 5, 6, 7, 8, 11, 12, 13 y 14 corresponden a las muestras de sangre de los perros N°1,
2, 3, 4, 5, 6, 7, 8, 9 y 10 respectivamente. El carril 15 corresponde al perro N°11 (Ver Cuadro 1).
12
c.- Secuenciación de fragmentos amplificados y análisis bioinformático de las
secuencias nucleotídicas de los fragmentos de DNA
Los fragmentos de DNA provenientes de dos muestras consideradas positivas (canino N°1
y canino N°3, Cuadro 1), fueron enviados a secuenciar por triplicado al Centro de
Secuenciación de Genytec Ltda, obteniéndose cinco secuencias para cada muestra
(Anexo_1). El criterio de selección de estas muestras se basó en las edades de los animales,
donde se eligió el canino N°1, de seis años, que es la edad donde se presentaría con mayor
frecuencia una encefalitis crónica debido a la infección por VDC, la cual podría estar
relacionada con mayores variaciones nucleotídicas de acuerdo a Frisk et al. (1999).
Asimismo se eligió el canino N°3, de once meses, que es la edad en la que generalmente se
encuentran más animales infectados por VDC (menores de un año).
Luego las secuencias fueron alineadas utilizando el programa ClustalW, obteniéndose una
secuencia de consenso para cada muestra utilizada: del canino N°1 se obtuvo la secuencia
CDV/CMC1 y del canino N°3 se obtuvo la secuencia CDV/CMC2 (Anexo 2).
A continuación, las secuencias consenso fueron ingresadas al programa BLAST, para
identificar el origen de los fragmentos de DNA obtenidos en la RT-PCR, lo que reveló que
la secuencia CDV/CMC1 presentó un porcentaje de identidad nucleotídica del 95% y la
secuencia CDV/CMC2 del 94%, respecto a los primeros cien resultados correspondientes a
VDC, y que en el caso de ambas secuencias, éstas correspondieron a VDC (Anexo 3).
Además según el análisis de las secuencias, la secuencia CDV/CMC1 y CDV/CMC2
mostraron un porcentaje de identidad nucleotídica de 98/97; 97/95 y 96/95%, respecto a las
cepas vacunales Onderstepoort, Lederle y Snyder Hill respectivamente (Anexo 4).
Por otra parte las secuencias CDV/CMC1 y CDV/CMC2 fueron comparadas mediante el
programa BLAST con otras secuencias del gen N del VDC, representantes de tres linajes
del virus (América 1, América 2 y Asia 1), de acuerdo a la clasificación de Gámiz et al.
(2011). La secuencia CDV/CMC1 presentó un porcentaje de identidad nucleotídica de
alrededor de un 97, 95 y 94% en relación a los linajes América 1, Asia 1 y América 2
respectivamente. La secuencia CDV/CMC2 presentó un porcentaje de identidad
nucleotídica de alrededor de un 96, 94 y 93% en relación a los linajes América 1, Asia 1 y
América 2 respectivamente (Anexo 5).
13
Sumado a lo anterior, las secuencias consenso fueron alineadas con el programa BLAST,
encontrándose un porcentaje de identidad nucleotídica del 95% entre ellas (Anexo 6).

DISCUSIÓN
El DC, es una enfermedad de distribución mundial, viral y altamente contagiosa, que afecta
a una amplia gama de carnívoros terrestres y algunos mamíferos marinos, los cuales han
tenido un aumento progresivo en los últimos años, infectándose incluso animales con sus
planes de vacunación al día. Es debido a este aumento de hospederos, que es trascendental
un diagnóstico certero de la enfermedad causada por el VDC, para limitar la diseminación
del mismo a otros animales y para dar un tratamiento oportuno a los enfermos.
Si bien el diagnóstico de DC se basa principalmente en los signos clínicos del paciente, en
ciertas ocasiones, es difícil llegar a un diagnóstico final por esta vía, ya que los principales
signos respiratorios y digestivos son comunes a otras enfermedades que afectan a los
caninos y en el caso de los signos clínicos más específicos del DC, como signos nerviosos,
éstos ocurren más comúnmente en las etapas posteriores de la infección, después de que
ésta se ha hecho más generalizada. Asimismo, las distintas presentaciones clínicas del DC
varían de un animal a otro, haciendo más complejo el diagnóstico final (Appel y Summers,
1999; Shin et al., 2004).
Si bien existen variadas técnicas para ayudar al diagnóstico del DC, como por ejemplo, el
aislamiento del virus, la inmunofluorescencia y la prueba de ELISA, la mayoría de éstos
métodos son laboriosos, consumen mucho tiempo y pueden dar resultados falsos, por lo
cual no son convenientes para el diagnóstico ante-mortem definitivo de la enfermedad.
Por esta razón, es necesario un método sensible, específico y rápido para descubrir una
pequeña cantidad del virus tempranamente en la infección, lo que gracias al desarrollo de
técnicas biológicas moleculares como la RT-PCR puede ser posible, donde se requiere una
secuencia blanco bien conservada entre diferentes cepas del VDC, para evitar desajustes de
los partidores y la posterior falla al amplificar la misma.
En base a lo anterior, en este trabajo se implementó un método diagnóstico para VDC
mediante la RT-PCR, basado en la detección del gen de la proteína de la nucleocápside, una
región altamente conservada del genoma VDC, lo que hace que este gen sea un buen blanco
14
para la detección molecular de este virus. De hecho, varios autores han revelado la
idoneidad de los métodos de biología molecular basados en el gen de la proteína de la
nucleocápside para la detección del VDC (Frisk et al., 1999; Calderón et al., 2007; Castilho
et al., 2007; Gallo et al., 2007; Gámiz et al., 2011; Shin et al., 2004). Adicionalmente, los
partidores utilizados en este estudio, se encuentran localizados en la región más conservada
del gen de la proteína de la nucleocápside, la zona central, lo cual aumentaría la
sensibilidad del método (Frisk et al., 1999; Gallo et al., 2007)
Aunque en nuestra facultad se han realizado dos memorias de título fundamentadas en la
RT-PCR del VDC (Jara, 2011; Salas, 2013), éstas se basaron en el gen de la hemaglutinina,
el cual posee la mayor variación antigénica y genética entre los genes del VDC,
presentando alrededor de un 10% de variabilidad entre diferentes cepas de VDC, lo cual no
lo hace el gen más adecuado para el diagnóstico del virus (Gallo et al., 2007; Martella et
al., 2008).
En el presente estudio se confirmaron las observaciones anteriores de la utilidad de RTPCR
del gen de la proteína de la nucleocápside del VDC, encontrándose el RNA del virus
en cerca del 91% (10/11) de las muestras de campo sospechosas de DC (Figura 2). Este
resultado sugiere que el protocolo utilizado en esta memoria de título, desde la obtención de
la capa flogistíca hasta la visualización de los productos amplificados, podría ser altamente
sensible. Al mismo tiempo, este método sería más sensible que los protocolos
implementados en los trabajos anteriores, ya que Salas (2013), sólo encontró el RNA viral
en el 7% (3/42) de las muestras analizadas que provenían de perros sospechosos de DC y
en el caso de Jara (2011), éste encontró el RNA del virus en el 83% (5/6) de las muestras
analizadas, que habían sido confirmadas anteriormente como positivas por otra RT-PCR,
sin embargo en veinte muestras de campo de perros sospechosos de DC, no encontró el
RNA viral (Jara, 2011). No obstante, para corroborar la sensibilidad del método
implementado, se requieren estudios adicionales.
La especificidad del método fue corroborada con la amplificación del fragmento esperado
en el 100% (10/10) de los controles positivos y en la no amplificación del fragmento
esperado en los controles negativos (Figura 1).
15
En cuanto a los controles negativos, es importante destacar que uno de los animales usados
para estos controles, presentaba su calendario de vacunación al día y había sido vacunado
por última vez hace diez meses, lo cual apoya las observaciones preliminares de que una
vacunación anterior no causa resultados falsos – positivos (Frisk et al., 1999).
Por otra parte, el VDC puede permanecer activo indefinidamente a -70 °C, -192 ºC
(nitrógeno líquido) o liofilizado y sólo se mantiene activo por alrededor de un mes a -10 °C
(Pérez et al., 1993), sin embargo en los controles positivos correspondientes a RNA del
VDC (proveniente desde aislados nacionales), es importante destacar que este RNA había
sido guardado por más de un año a -20 °C, la cual no es la temperatura ideal para mantener
la integridad y no degradación del mismo, pero a pesar de esto, la estabilidad del RNA del
virus no se vio afectada.
En cuanto al tipo de muestra elegida para las muestras de campo, se escogió sangre con
anticoagulante (ácido etilendiaminotetraacético “EDTA”), debido a que es una de las más
conveniente como substrato para la RT-PCR, ya que es una muestra fácil de obtener,
mantiene la morfología celular por más tiempo impidiendo que el RNA viral sea
degradado por RNAsas endógenas al salir de la célula y además la cantidad de EDTA
presente en los tubos para la obtención de sangre, no inhibiría el resultado de la RT-PCR
(Khosravinia y Ramesha, 2007). No obstante, también se han visto resultados similares con
muestras de suero y orina, aumentando aun más la sensibilidad de la detección si se utiliza
más de una para el diagnóstico de la enfermedad (Frisk et al., 1999; Shin et al., 2004).
Hasta ahora, la confirmación de la infección de VDC en perros vivos no era útil,
principalmente debido al bajo nivel de sensibilidad de los métodos disponibles, como por
ejemplo, la prueba de ELISA, donde el hallazgo de anticuerpos neutralizantes en general
no guarda correlación con los resultados de la RT-PCR (Frisk et al., 1999), tal como se dio
en este estudio, donde algunos animales positivos a la infección por VDC presentaban
títulos de anticuerpos inferiores a los considerados positivos (<1:80 a="" indicar="" lo="" p="" podr="" que="">el papel no contribuyente de los títulos de anticuerpos neutralizantes para el diagnóstico
etiológico de la enfermedad.
La muestra de campo sospechosa de DC que resultó negativa después de ser analizada por
el método propuesto (canino N°11, Cuadro 1), pudo deberse a la ausencia de RNA viral, ya
16
sea porque el virus no se encontraba en sangre, pudiendo estar localizado en otros epitelios
del organismo o porque la muestra fue mal conservada o mal procesada.
Si bien la enfermedad DC es menos frecuente en países desarrollados debido a la
inmunización, en años recientes, el virus que la produce ha surgido como un patógeno
significativo de poblaciones de animales vacunados, y en el caso de este estudio, se
muestra la presencia de algunos animales enfermos de DC, que a lo menos fueron
vacunados una vez contra el virus, lo cual plantea la hipótesis de la falla en la
inmunización de la vacuna, lo que podría estar dado por planes de vacunación incorrectos
o por variaciones genéticas del virus (Castilho et al., 2007), sin embargo para dar respuesta
a estas presunciones es necesaria la realización de otros estudios sobre el tema.
Luego de obtener las secuencias de dos de las muestras que amplificaron un fragmento de
aproximadamente 290 pb y definir la secuencia de consenso para cada una de ellas (Anexo
2), se utilizó el programa BLAST, donde se obtuvo que ambas secuencias presentaron un
porcentaje de identidad nucleotídica mayor al 94% respecto a los primeros cien resultados
correspondientes a VDC y que en ambos casos los fragmentos amplificados pertenecían a
este virus, corroborándose la especificidad de método implementado.
Al alinear las secuencias consenso (CDV/CMC1 y CDV/CMC2) mediante el programa
BLAST, se encontró un porcentaje de identidad nucleotídica del 95% entre ellas, por lo
cual no habrían mayores variaciones entre ambas secuencias (Anexo 6).
Tanto la secuencia CDV/CMC1 como la secuencia CDV/CMC2, mostraron mayor
homología a la cepa Onderstepoort del VDC (98/97% respectivamente) (Anexo 4), similar
a los valores encontrados por Castilho et al. (2007).
A pesar que los fragmentos amplificados se encuentran en una zona altamente conservada
del genoma VDC (gen N), se encontró una variación de las secuencias consenso respecto a
la cepa Onderstepoort de alrededor del 2 – 3%. La posibilidad de que estas substituciones
nucleotídicas pudieran tener un impacto luego de la traducción viral, tiene que ser
justificada por estudios adicionales. Sin embargo en el caso de la secuencia CDV1/CMC1
se presenta una sustitución de un codón respecto a la cepa Onderstepoort (GGG por CCC,
posición 1026 al 1028 de la cepa Onderstepoort, Anexo 4), lo cual podría ocasionar un
cambio aminoacídico pudiendo modificar la estructura de la proteína. Asimismo en 1998,
17
Yoshida et al. encontraron que aislados de VDC en Japón tenían un grupo de
substituciones nucleotídicas que los distinguieron de la cepa de laboratorio Onderstepoort,
pero que estas substituciones de secuencia no tenían correlación con diferencias en la
patología de la enfermedad (Yoshida et al., 1998).
Según el análisis genómico de las secuencias CDV/CMC1 y CDV/CMC2, donde éstas
fueron comparadas con otras secuencias del gen N del VDC (representantes de tres linajes
del virus), ambas secuencias presentaron mayor similitud según el porcentaje de identidad
nucleotídica, al linaje América 1 (Anexo 5).
La técnica implementada, permitiría el aislamiento temprano de los animales infectados y
la instauración de un tratamiento adecuado. Además en el caso de animales silvestres, el
diagnóstico rápido y específico que otorga este método, podría ayudar a la conservación de
especies protegidas, las cuales se han visto en riesgo debido al aumento dramático de
hospederos de VDC acontecido en los últimos años.
CONCLUSIONES
El sistema implementado, representa un método diagnóstico ante-mortem rápido y
específico de la enfermedad Distemper Canino, resultando ser eficaz para la detección del
virus.
La estabilidad del RNA del Virus Distemper Canino, no fue alterada al ser mantenido por
más de un año a -20 °C.
Según el análisis genómico de las secuencias CDV/CMC1 y CDV/CMC2, ambas
mostraron mayor similitud a la cepa Onderstepoort del Virus Distemper Canino y por otro
lado, ambas secuencias mostraron mayor similitud al linaje América 1 del Virus Distemper
Canino.
En base a los resultados de este estudio, el método implementado puede colaborar con la
prevención y el control del aumento de Distemper Canino, ya que éste otorga un
diagnóstico rápido y específico para la identificación del virus responsable, lo cual podría
ayudar a mejorar la salud de la población canina, así como la de otros animales que son
susceptibles a la enfermedad.
18
BIBLIOGRAFÍA

 APPEL, M.; SUMMERS, J. 1999. Distemper canino: estado actual. Institute for
Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, New
York, USA. 5p.
 BEINEKE, A.; PUFF, C.; SEEHUSEN, F.; BAUMGARTNER, W. 2009.
Pathogenesis and immunopathology of systemic and nervous canine Distemper.
Veterinary Immunology and Immunopathology 127: 1-18.
 BERRÍOS, P.; DURÁN, C. 2005. Principales enfermedades virales de los
caninos. Situación en Chile. Monografías Electrónicas de Patología Veterinaria
2: 68-93.
 CALDERÓN, M.; REMORINI, P.; PERIOLO, O.; IGLESIAS, M.; MATTION,
N.; LA TORRE, J. 2007. Detection by RT‐PCR and genetic characterization of
canine Distemper virus from vaccinated and non‐vaccinated dogs in Argentina.
Veterinary Microbiology 125: 341‐349.
 CASTILHO, J.; BRANDÃO, P.; CARNIELI, P.; OLIVEIRA, R.; MACEDO,
C.; PEIXOTO, Z.; CARRIERI, M.; KOTAIT, I. 2007. Molecular analysis of
the N gene of canine Distemper virus in dogs in Brazil. Arquivo Brasileiro de
Medicina Veterinária e Zootecnia 59: 654-659.
 CERDA, L.; MATHIEU, C.; QUINTEROS, G. 1994. Primer aislamiento de Virus
Distemper Canino en Chile. XIV Congreso Panamericano de Ciencias
Veterinarias. Acapulco, México.
 FRISK, A.; KÖNIG, M.; MORITZ, A.; BAUMGÄRTNER, W. 1999. Detection
of canine Distemper virus nucleoprotein RNA by reverse transcription-PCR
using serum, whole blood, and cerebrospinal fluid from dogs with Distemper.
Journal of Clinical Microbiology 37: 3634–3643.
 GALLO, M.; REMORINI, P.; PERIOLO, O.; IGLESIAS, M.; MATTION, N.;
LA TORRE, J. 2007. Detection by RT-PCR and genetic characterization of
canine Distemper virus from vaccinated and non-vaccinated dogs in Argentina.
Veterinary Microbiology 125: 341–349.
 GÁMIZ, C.; MARTELLA, V.; ULLOA, R.: FAJARDO, R.; QUIJANO, I.;
MARTÍNEZ, S. 2011. Identification of a new genotype of canine Distemper
virus circulating in America. Veterinary Research Communications 35: 381–390.
 JARA, C.; MATUS, P.; MOREIRA, R 2007. Distemper Canino en Isla Robinson
Crusoe (Archipiélago Juan Fernández, V Región): antecedentes de un brote
epidémico. Boletín Veterinario Oficial. SAG, Chile 8: 1-19.
 JARA, P. 2011. Detección del gen de la hemoaglutinina del Virus Distemper Canino
mediante la reacción en cadena de la polimerasa asociada a transcripción inversa.
Memoria Título Médico Veterinario. Santiago, Chile. U. Chile, Fac. de Ciencias
Veterinarias y Pecuarias. 18 p.
19
 KEAWCHAROEN, J.; THEAMBOONLERSC, A.; JANTARADSAMEEC, P.;
RUNGSIPIPATB, A.; POOVORAWANC, Y.; ORAVEERAKULA, K. 2005.
Nucleotide sequence analysis of nucleocapsid protein gene of canine Distemper
virus isolates in Thailand. Veterinary Microbiology 105: 137–142.
 KHOSRAVINIA, H; RAMESHA, K. 2007. Influence of EDTA and magnesium on
DNA extraction from blood samples and specificity of polymerase chain
reaction. African Journal of Biotechnology 6 (3): 184-187.
 LARSON, L.; SCHULTZ, R. 2006. Effect of vaccination with recombinant canine
Distemper virus vaccine immediately before exposure under shelter-like
conditions. Vet Ther 7: 113-118.
 MARTELLA, V.; ELIA, G.; BUONAVOGLIA, C. 2008. Canine Distemper virus.
Veterinary Clinics of North America Small Animal Practice 38: 787–797.
 MEE, A.; DIXON, J.; HOYLAND, J.; DAVIES, M.; SELBY, P.; MAWER, E.
1998. Detection of canine Distemper virus in 100% of Paget’s disease samples
by in situ-reverse transcriptase-polymerase chain reaction. Bone 23: 171-175.
 MOREIRA, R.; STUTZIN, M. 2005. Estudio de la mortalidad de zorros en la IV
Región. Boletín Veterinario Oficial. SAG, Chile 3: 1-8.
 PÉREZ, S.; ITURBE, R.; SALDÍVAR, E. 1993. Caracterización del virus del
Distemper (moquillo canino) en cultivos celulares, aislado de animales
clínicamente enfermos. Veterinaria México 24 (1): 15-19.
 SALAS, V. 2013. Análisis filogenético del gen de la hemaglutinina del Virus
Distemper Canino en perros infectados naturalmente en Chile. Memoria Título
Médico Veterinario. Santiago, Chile. U. Chile, Fac. de Ciencias Veterinarias y
Pecuarias. 23 p.
 SHIN, Y.; CHO, K.; CHO, H.; KANG, S.; KIM, H.; KIM, Y.; PARK, H.;
PARK, N. 2004. Comparison of one-step RT-PCR and a nested PCR for the
detection of canine Distemper virus in clinical samples. Australian Veterinary
Journal 82: 83-86.
 SIDHU, M.; HUSAR, W.; COOK, S.; DOWLING, P.; UDEM, S. 1993. Canine
Distemper terminal and intergenic non-protein coding nucleotide sequences:
completion of the entire CDV genome sequence. Virology 193: 66-72.
 SUMMERS, B.; APPEL, M. 1994. Aspects of canine Distemper virus and measles
virus encephalomyelitis. Neuropathology and Applied Neurobiology 20: 525-
534.
 VON MESSLING, V.; ZIMMER, G.; HERRLER, G.; HAAS, L.; CATTANEO,
R. 2001. The hemagglutinin of canine Distemper virus determines tropism and
cytopathogenicity. Journal of Virology 75 (14): 6418–6427.
 YOSHIDA, E.; IWATSUKI, K.; MIYASHITA, N.; GEMMA, T.; KAI, C.;
MIKAMI, T. 1998. Molecular analysis of the nucleocapsid protein of recent
isolates of canine Distemper in Japan. Veterinary Microbiology 59: 237–244.

miércoles, 20 de abril de 2016

ARTERITIS VIRAL EQUINA José F. Rivas T. 2016


ARTERITIS VIRAL EQUINA 

José Felipe Rivas Troncoso


PRIMER AISLAMIENTO Y CARACTERIZACIÓN FILOGENETICA DEL VIRUS DE LA ARTERITIS VIRAL EQUINA A PARTIR DE MUESTRAS DE BURROS ASILVESTRADOS (EQUUS AFRICANUS ASINUS) DE LA REGION DE ATACAMA, CHILE

 FIRST ISOLATION AND PHYLOGENETIC CHARACTERIZATION OF EQUINE ARTERITIS VIRUS OF THE SAMPLE EQUUS AFRICANUS ASINUS FROM ATACAMA REGION, CHILE.


 El objetivo de este estudio fue aislar y caracterizar filogenéticamente el virus de la Arteritis Viral Equina (AVE), desde muestras de burros (Equus africanus asinus) serológicamente positivos, provenientes de la Región de Atacama, Chile. Se procesaron muestras de corazón, pulmón, riñón, testículos, conducto deferente, epidídimo, próstata y vesícula seminal pertenecientes a 2 animales, la muestra de conducto deferente fue positiva a la técnica de RT-PCR para los segmentos ORF5, ORF6 y ORF7 las que posteriormente fueron secuenciadas. Además, se realizo aislamiento viral en cultivo celular utilizando la línea celular RK-13, del que se obtuvo un aislado. La cepa Chilena denominada cepa Atacama presentó una similitud nucleotídica 64,9% y aminoacídica 81,4% al compararla con la cepa de referencia Bucyrus. Mediante el análisis de porcentajes de identidad y la confección de árboles filogenéticos, se evidenció que el aislado chileno es una cepa nueva, ya que no hay reportes anteriores de un aislado con estas características genética que además, se encuentra muy alejada filogenéticamente de las cepas de referencia descritas en la literatura. La cepa Atacama se relacionó con aislados de asnales sudafricanos (J1-931125) presentando una similitud nucleotídica de 78,6% y aminoacídica de 93,1%, lo que la clasificaría dentro del subgrupo Europeo-2 según Zhang et al (2007).
 Palabras clave: Aislamiento Viral, Análisis Filogenético, ORF5. 

 II. SUMMARY FIRST ISOLATION AND PHILOGENETIC CHARACTERIZATION OF EQUINE VIRAL ARTERIRITS FROM EQUUS AFRICANUS ASINUSSAMPLESON THE ATACAMA REGION, CHILE The aim of this research was to isolate, and phylogenetically characterize the Equine Viral Arteritis (EVA) virus, taken from samples of serologically positive asses (Equus africanus asinus) from the Atacama Region, Chile. Processed samples include heart, lung, kidney, testicle, vas deferens, epididymus, prostate, and seminal vesicle tissue, taken from two animals. Vas deferens samples were positive for the Reverse transcription - polymerase chain reaction (RT-PCR) technique for segments ORF5, ORF6, and ORF7, which were subsequently sequenced. In addition the study conducted a virus isolation procedure using the RK-13 cell line. The Chilean virus strain also known as Atacama Strain showed a nucleotide similarity of 64.9% and an amino acid similarity of 81.4%, when compared to the Bucyrus reference sample. Through the analysis of identity percentages and the making of phylogenetic trees, the study revealed the fact that the obtained isolation is a new strain, as there is no record of an isolation with such genetic characteristics, which are substantially phylogenetically distinct from the reference strains depicted on the available literature. The Atacama Strain showed to be phylogenetically related with isolations of African origin (J1-931125) presenting a nucleotide similarity of 78.6%, and am amino acid similarity of 93.1%, which classifies it within the European-2 subgroup according to Zhang et al. (2007).
 Keywords: Virus Isolation, Phylogenetic Analysis, ORF5  

III. INTRODUCCIÓN

 La Familia Arteriviridae está compuesta por patógenos que afectan a distintas especies de mamíferos, entre los cuales se encuentran el virus del síndrome reproductivo respiratorio porcino (PRRSV), fiebre hemorrágica del simio (SHFV), arteritis viral equina (AVE) y el virus del aumento de la deshidrogenasa láctica en ratones (LDV) (de Vries et al., 1997, Snijder et al., 2013). Últimamente se ha descubierto un virus que afecta a las zarigüeyas en Australia (Trichosurus vulpecula) síndrome de la zarigüeya floja (wobbly possum disease (WPD)) (Dunowska et al., 2012). Tanto AVE como PRRS cursan con cuadros respiratorios y abortivos, generando grandes pérdidas a nivel productivo (Snijder et al., 2013).

 Etiología
 El virus de la AVE afecta a miembros de la Familia Equidae (caballos, burros, mulas y cebras) (Stadejek et al., 2006), pertenece al Género Arterivirus, Familia Arteriviridae y Orden Nidovirales (Snijder y Meulenberg, 1998, Snijder et al., 2013). Posee un genoma de una hebra de ARN, lineal de sentido positivo (Gorbalenya et al., 2006), tiene un diámetro de 40 a 60 nm (Deshpande et al., 2007). La longitud del genoma es de 12704 a 12731 pares de bases y posee diez marcos abiertos de lectura (ORF) 1a, 1b, 2a, 2b, 3, 4, 5a, 5b, 6 y 7 (de Vries et al., 1992, Firth et al., 2011). ORF 1a y 1b ocupan tres cuartas partes del genoma total del virus y codifican para las proteínas no estructurales: poliproteína 1a, poliproteína 1ab, y nsp1 – nsp12 incluidos nsp1, 2 y 4 que corresponden a proteasas virales (Balasuriya et al., 2013). En tanto, los ORF 2a, 2b, 3, 4, 5, 6, junto con ORF 7 ocupan el cuarto restante del genoma, codificando las proteínas de envoltura (E, GP2, GP3, GP4, proteína ORF5a, GP5 y M respectivamente) y ORF 7 codifica para Nucleocapside (N) (Balasuriya et al., 2013). Las proteínas de envoltura más abundantes son GP5 y M y juntas forman el complejo mayor de envoltura.Las restantes E, GP2, GP3 y GP4 forman el complejo menor de envoltura (de Vries et al., 1992, Wieringa et al., 2004). El principal serotipo identificado es la cepa Bucyrus (Snijder et al., 2013). Las cepas de AVE se dividen en dos grupos, norteamericano (NA) y europeo (EU), éste a su vez se subdivide en dos 4 subgrupos, subgrupo europeo 1 (EU-1) y subgrupo europeo 2 (EU-2) (Balasuriya et al., 1995b, Zhang et al., 2007).

 Epidemiologia

 El virus de la AVE se aisló por primera vez en 1953 en Bucyrus, Ohio, EEUU; en un criadero de caballos Standardbred a partir de equinos con cuadro respiratorio y fetos abortados (Doll et al., 1957). En la actualidad, la enfermedad presenta una distribución mundial y solo se consideran libres Japón e Islandia (Rola et al., 2011). Además, un estudio reciente ha evidenciado la ausencia de arteritis viral equina en la población de caballos de Nueva Zelanda (McFadden et al., 2013). El aumento en el movimiento de equinos a nivel mundial, la inseminación artificial, la carencia de medidas de bioseguridad y fallas en el cumplimiento de las medidas de control, ha incrementado la diseminación del virus (Rola et al., 2011). Estudios serológicos en equinos han demostrado una prevalencia en Europa superior al 20% a excepción de Gran Bretaña que no sobrepasa el 2% (Glaser et al., 1997; Rola et al., 2011), Polonia 17,4% (Larska y Rola, 2008), Suiza 11,3%, (Holyoaket al., 2008), Estados Unidos 1,9% en caballos propios y en caballos importados, un 19,4% en hembras y un 16,1% en machos (Hullinger et al., 2001). En Estados Unidos, se observa una variación dependiendo de la raza, es así como, los caballos Standardbred presentan prevalencias de 77,5 a 84,3% y los caballos Thoroughbred van desde 0 a 5,4% (Holyoak et al., 2008) La transmisión del virus puede ser de forma horizontal como vertical. El contagio horizontal puede ser por vía respiratoria por contacto con aerosoles o secreciones respiratorias de otros equinos con infección aguda, orina, membranas fetales de abortos (Timoney y McCollum, 1987, Balasuriya, 2014) o infección ambiental con semen de potros con infección crónica (Guthrie et al., 2003). La hembra también se puede contagiar vía venera por monta natural desde el macho portador crónico, por inseminación artificial o transferencia de embriones (Timoney y McCollum 1988, Balasuriya, 2014). El contagio vertical se produce cuando una hembra preñada se infecta con AVE, si ésta llega al término de la gestación el potrillo nace 5 infectado, muriendo a los pocos meses de vida (Glaser et al., 1996, Timoney y McCollum, 1996). En machos, después de la infección aguda, el virus se aloja en el ámpula y las glándulas sexuales accesorias generando un estado de portador o infectado crónico entre 10 y 70% de los machos infectados, el cual es testosterona dependiente (Balasuriya, 2014), éste estado se da solo en machos enteros (no castrados), mayores a 6 meses y es la principal forma de mantención del virus en la naturaleza (Timoney y McCollum, 1988). Signos Clínicos El periodo de incubación del virus es de 2 a 14 días, en la exposición venérea es de 6 a 8 días promedio, seguido por un periodo de fiebre de 2 a 9 días (Balasuriya et al., 2013). Al ingresar el virus por vía respiratoria alta, replica en las células del epitelio e infecta a nivel pulmonar los macrófagos alveolares dentro de las primeras 24hrs post-infección (PI). Luego, migra a los linfonódulos regionales, principalmente bronquiales a las 48hrs PI, presentándose la viremia dentro de los 3 días PI (McLachland et al., 1996). En machos enteros, se genera el estado de portador del virus en el periodo virémico. 10 días PI se genera severo daño al endotelio vascular, y aborto en hembras gestantes. 10 a 21 días PI el virus migra al epitelio de los túbulos renales y el virus es diseminado por la orina (Del Piero, 2000). La presentación de los signos clínicos depende de varios factores incluidos genéticos, edad, condición corporal, dosis infectante, ruta de infección, cepa viral y factores ambientales (Balasuriya, 2014). El signo más común es la fiebre, en el hemograma se observa una marcada leucopenia, pero en los casos de animales jóvenes, muy viejos, débiles o inmunodeprimidos pueden presentar además decaimiento, anorexia, rinitis mucopurulenta, edema en declive (escroto, prepucio, glándula mamaria, ventral al tronco y miembros), problemas en la marcha (rigidez al caminar), lagrimeo, conjuntivitis, edema periorbital y supraorbital, diestress respiratorio, urticaria desde la cara y cuello hacia el resto del cuerpo (Glaser et al., 1996; Del Piero. 2000; Balasuriya, 2014). Dependiendo de la cepa viral, en hembras de 3 a 10 meses de gestación genera aborto entre 10 a 70% 6 aproximadamente (Vaala et al., 1992). Este se atribuye al daño en el miometrio producido por la replicación viral lo que disminuye la irrigación fetal, generando estrés y desencadenando el aborto (McLachland et al., 1996). En los fetos abortados, se observan pulmones con edema interlobulillar, efusión pericardica y pleural, petequias y equimosis tanto en mucosa como en serosa del intestino delgado. Histológicamente se evidencia una panvasculitis necrotizante en pequeños vasos, estas lesiones se pueden observar en la placenta, cerebro, hígado y bazo del feto (Balasuriya, 2014).

 En la naturaleza, se observa mortalidad solo en neonatos, éstos presentan cuadros de neumonía intersticial fulminante, los potrillos que sobreviven desarrollan, un síndrome neumo-entérico, entre 1 y 3 meses de edad (Vaala et al., 1992). Mortalidad en adultos solo se ha observado en infecciones experimentales (McLachland et al., 1996). Se describe una resistencia genética al virus asociado a linfocito T CD3+, los animales resistentes presentan mayor signología clínica, asociada a una mayor respuesta inmune (Go et al., 2012). Diagnostico En caso de sospecha de AVE debido a la sintomatología, es necesario realizar un diagnostico confirmatorio para determinar el agente etiológico, ya que dependiendo del lugar geográfico, hay distintos agentes que presentan similar sintomatología, es así el caso de Herpesvirus Equino tipo 1 y 4, Influenza Equina, Anemia Infecciosa Equina, Adenovirus Equino y Leptospira (Balasuriya, 2014). La identificación del agente se puede realizar por medio de aislamiento viral para el cual se recogen muestras de sangre no coagulada, muestras nasofaríngeas (Westcott et al., 2003), conjuntivales, y semen de los posibles portadores. En brotes de aborto y potrillos mortinatos se toman muestras de líquidos fetales y placentarios y tejido, idealmente pulmón (OIE, 2013). Esta es una prueba aprobada por la Organización Internacional de Epizootias (OIE, 2013) en esta prueba se inocula el virus desde las muestras antes mencionadas en cultivos celulares de monocapa la cual puede ser de riñón de conejo (RK-13 (Asagoe et al., 1997)) o riñón de hámster bebe (BHK-21) (Wagner et al., 2003). Los cultivos 7 se revisan todos los días, de estos, los positivos deberán presentar efecto citopático dentro de 2 a 6 días. El cual se verificara con pruebas como anticuerpos mono y policlonales, inmunohistoquímica y RT-PCR estándar o a tiempo real (OIE, 2013; Balasuriya, 2014) Los métodos serológicos más utilizados para determinar la presencia de AVE se encuentran la seroneutralización viral (SNV) (OIE, 2013), ensayo por inmunoabsorción ligado a enzima (ELISA) (Mertz et al., 2014). La SNV es uno de los métodos más utilizadas debido a su sensibilidad y eficiencia, ha sido implementada por la Organización Internacional de Epizootias (OIE), como prueba de referencia para diagnostico de la enfermedad. Se utilizan muestras de sangre estéril, uso de células monocapa RK-13 y como virus, cepa CVL-Bucyrus o cepa vacinal MLV atenuada. Los sueros positivos se determinan microscópicamente por efecto citopático entre 48 y 72hrs post inoculación, el cual se considera positivo si no hay reducción del cultivo celular en comparación a los pocillos control (OIE, 2013). El uso de ELISA es otra prueba serológica ampliamente difundida para detectar anticuerpos contra AVE. Estos son de carácter directo (Wagner et al., 2003) o indirecto (Chung et al., 2013) los que van dirigidos a la proteína GP5, la cual estimula la respuesta inmune humoral (Chung et al., 2013). Esta prueba presenta símil especificidad y sensibilidad que seroneutralización, pero a diferencia de esta se pueden obtener reacciones positivas antes. Se han descrito ELISAS con una especificidad 99,5% de especificidad y 98,2% (Chung et al., 2013) en comparación a seroneutralización viral. El uso de métodos moleculares, RT-PCR convencional (Liu et al., 2008), RT-PCR tiempo real (Balasuriya et al., 2002a, Miszczak et al., 2011), RT-PCR anidado (Westcott et al., 2003), se utilizan como métodos para complementar el aislamiento vírico en cultivo celular y para la identificación ARN específicos de muestras de semen, filtrados de hisopos nasofaríngeos, capas leucocitarias y muestras de tejido post-mortem (OIE 2013, Balasuriya et al., 2013). Estas pruebas van principalmente dirigidas a los ORF: 1b, 3, 4, 5, 6 y 7 (Balasuriya et al., 2013; 8 Liu et al., 2008; Rola et al., 2013). En donde ORF 5 es el segmento más confiable para determinar el grupo viral para lo cual se utiliza RT-PCR convencional (Stadejek et al., 1999; Zhang et al., 2007). Secuenciación y Análisis Filogenético El análisis filogenético se puede realizar desde ORF1b a ORF7. Se han realizado arboles de ORF6 (Echeverría et al., 2007) y ORF 7 (Larska y Rola 2008), pero éstos no son tan confiables como ORF5. Este gen codifica para la glicoproteína (GP5), la cual forma parte del complejo mayor de envoltura, siendo la proteína de mayor variabilidad antigénica (Stadejek et al., 1999; Hornyak et al., 2005; Mittelholzer et al., 2006; Zhang et al., 2007, Surma-Kurusiewicz et al., 2013). ORF5 con un tamaño de 768 pares de bases (pb) (Balasuriya et al., 2013), se divide en tres segmentos variables (V1, V2, V3) y cuatro segmentos conservados (C1, C2, C3, C4). Tiene 4 sitios mayores de neutralización en el ectodominio (A,B,C,D), los que junto con la proteína M generan los epítopos neutralizantes (Balasuriya et al., 2004a). B, C y D se encuentran dentro del segmento V1 (Balasuriya et al., 1995a, Balasuriya et al., 1997, Rola et al., 2013). Este segmento es el menos conservado dentro de ORF5 y es el que genera nuevas variantes del virus AVE (Hornyaket al., 2005, Surma-Kurusiewicz et al., 2013). La variación de estos ectodominios se debe a que el virus está en constante presión por el sistema inmune lo que genera por medio de la pérdida y adición de sitios de glicosilación, la variación de la proteína viral (Zhang et al., 2007) Este proceso se lleva a cabo durante el estado portador en machos (Balasuriyaet al., 2004a). De AVE solo existe un solo serotipo Bucyrus (GenBank Nº NC_002532) (Snijder et al., 2013), el cual se divide en dos grupos, uno Norteamericano (NA) y otro Europeo (EU), este ultimo a su vez se divide en 2 subgrupos EU-1 y EU-2 (Zhang, 2007) Dentro del grupo norteamericano también clasificado como IA y IB según Stadejek et al (1999) o EAV-2, por Mittelholzer et al (2006), se encuentran cepas aisladas en Nueva Zelanda, Canadá, Estados Unidos, Gran Bretaña, Dinamarca, Hungría (Hornyak et al., 2005), Noruega, Países Bajos, cepa vaccinal ARVAC 9 (Zhang, 2007). En tanto en el subgrupo EU-1 (IIA por Stadejek et al (1999) o EAV- 1 por Mittelholzer et al (2006)) se encuentran cepas de Francia, Hungría, Qatar, Gran Bretaña, Austria, Alemania, Polonia (Rola et al., 2013), Italia, Bélgica y Sudáfrica (Zhang, 2007). En tanto en el subgrupo EU-2 (IIB por Stadejek et al (1999), EAV-3 por Mittelholzer (2006)) se encuentran aislados de Hungría, Austria (Hornyak et al., 2005), Suecia, Noruega, Gran Bretaña, Italia, Hungría, Dinamarca, Sudáfrica (aislado desde burros) (Mittelholzer et al., 2006; Zhang et al., 2007). Y Argentina (Metz et al., 2008). Dentro del grupo Norteamericano se han encontrado cepas de origen europeo (NL1, GB2) así como también se han encontrado en el grupo europeo cepas de origen norteamericano (USA8, USA18), lo cual se relaciona con movimiento de animales entre continentes (Stadejek et al., 1999; Mittelholzer et al., 2006). En el grupo EU-1 se han aislado 2 cepas europeas de burros en Italia (Stadejek et al., 1999) en tanto se han aislado 9 cepas de origen sudafricano de baja patogenicidad y virulencia, las cuales se correlacionan entre sí con muy poca variabilidad, están incluidas dentro del grupo EU-2, sin embargo estas se encuentran muy alejadas filogenéticamente de las otras cepas del grupo, tampoco se encuentra en cercanía a las cepas de caballos lipizzanos sudafricanos que pertenecen al grupo EU-1, lo que sugiere que esta cepa es una variante única de AVE, la cual ha estado presente desde mucho tiempo atrás y es propia de la población de asnales (Zhang et al., 2007; Stadejek et al., 2006).

 Situación enChile

 Según el Decreto Exento Nº 389 (2014) AVE es una enfermedad de denuncia obligatoria al Servicio Agricola Ganadero (SAG).Hasta el año 2013, el virus de la arteritis viral equina no había sido descrito en Chile, como se observa en los registros de la lista de enfermedades de denuncia obligatoria de la OIE (WAHIS, 2015a). A partir de esta fecha, el SAG confirma el diagnóstico en un laboratorio de referencia internacional (SAG, 2014), por ello se notifica la presencia de la enfermedad a la OIE y Chile se reporta con un estado de infección o infestación 10 limitada a una o más zonas, adoptando medidas de control para su vigilancia general y dirigida (WAHIS, 2015b). Para el control de esta enfermedad se publica la resolución exenta Nº 4138 (2014), donde se establece la zona de control sanitario de AVE en población de asnales de las Comunas de Huasco, Freirina, Vallenar y la Higuera, para ello se procede a marcar machos enteros castrados y se prohíbe la salida de este perímetro a menos que sea castrado. La Comuna de Freirina, de Provincia de Huasco, en la Región de Atacama, es la Comuna a nivel nacional que presenta la mayor proporción de animales por productor del País, reportándose 51 existencias en promedio por cada uno de éstos (INE, 2007). En Chile, según el censo agropecuario 2007, hay una existencia de 15016 asnales en el país, la Región de Atacama y Coquimbo concentran el 80% de esta población: Coquimbo con 8784 existencias lo que corresponde al 58,4% y Atacama con 3357 existencias correspondientes al 22,3% de población de asnales del país (INE, 2007). Según el SAG a partir de un estudio serológico realizado por Moreira et al., (2014), habría una prevalencia de AVE de un 53% (312 muestras). El año 2014 el SAG reporta el último brote en burros asilvestrados (Equus africanus asinus) de la Región de Atacama (SAG, 2015). Aparte del estudio serológico realizado en Chile, no hay evidencia concreta de la presencia del virus, ya que aún no se ha aislado. Por este hecho, sería relevante aislar el virus para confirmar la infección y una vez aislado, efectuar un estudio filogenético, con él se podría determinar el tipo de cepa presente, la probable procedencia de ésta, si esta provendría desde caballos o desde asnales y si existe relación con cepas descritas en la literatura, según el grado de similitud que tenga con estas, o si se trataría de una cepa nueva. De esta forma es posible implementar medidas más eficaces de diagnostico, así de esta forma controlar la enfermedad. 11 Hipótesis HA0: Existe infección de arteritis viral equina en Equus africanus asinus con una cepa viral la cual no tiene relación genética con las cepas de caballos, en la región de Atacama, Chile HA1: Existe infección de arteritis viral equina en Equus africanus asinus con una cepa viral la cual tiene relación genética con las cepas de caballos, en la región de Atacama, Chile

 Objetivos

 Objetivo General ● Aislar y caracterizar filogenéticamente el virus de la arteritis viral equina desde muestras de Equus africanus asinus de la región de Atacama, Chile Objetivos Específicos ● Aislar el virus de arteritis viral equina mediante cultivo celular a partir de muestras de tejido de Equus africanus asinus serológicamente positivos. ● Diagnosticar infección de arteritis viral equina a partir de aislados celulares positivos mediante método RT-PCR para ORF 5, 6 y 7. ● Caracterizar filogenéticamente a través de secuenciación genética, los ORF 5,6,7 de AVE para determinar la existencia de una o más cepas ● Determinar la relación filogénica del virus de burro y las cepas de referencia. 

 IV. MATERIALES Y METODO

 Muestras Se analizaron, muestras de tejido a partir de necropsias, de 2 burros machos enteros serológicamente positivos provenientes de la Región de Atacama de la Comuna de Freirina, en la Provincia de Huasco. Éstos fueron adquiridos por la Unidad de Virología, Subdepartamento del Laboratorio y Estación Cuarentenaria Pecuaria, Lo Aguirre del SAG. A partir de estos individuos se analizaron muestras de tejidos provenientes de corazón, pulmón, riñón, testículos, conducto deferente, epidídimo, próstata y vesícula seminal. Estas muestras llegaron a la Unidad de Recepción de Muestras, del complejo. Las muestras, fueron enviadas a la subunidad de Virología donde se almacenaron a -40ºC, a estas posteriormente se les extrajo el material genético. Extracción de ARN Para determinar la presencia del virus en los tejidos, se utilizo el ensayo RT-PCR, para desarrollar esta prueba, primero fue necesario realizar extracción de ARN, para lo cual se utilizo un kit comercial (Ambion® AM 1835) en donde, la extracción se realizo siguiendo las especificaciones del fabricante. Una vez, obtenido el material genético, este fue enviado a la Unidad de Biotecnología del establecimiento. Donde se realizo el análisis RT-PCR. RT-PCR Diagnostico Para realizar ésta técnica, se utilizo un kit comercial (Qiagen® ONE STEP), siguiendo el protocolo recomendado por el fabricante. Posteriormente se procedió a la amplificación del segmento ORF6 y ORF7 siguiendo las recomendaciones según el manual de la OIE (2013), mediante el uso de un termociclador (Applied Biosystems® 2720 Thermal Cycler). Los productos de RT-PCR fueron pasados a un gel de agarosa al 1.5% teñido con bromuro de etidio, utilizando una fuente de poder (PolyScience®model 500-2) a 90 voltios por 45 minutos. Los productos de RT-PCR fueron reportados como positivos o negativos al ser visualizado por untransiluminador UV, considerándose positivo las bandas de 193 pares de bases (pb) para el RT-PCR contra ORF6 y 316pb para el RT-PCR contra ORF7 en las reacciones amplificadas. Las muestras que resultaron positivas, fueron seleccionadas para realizar la inoculación en cultivo celular. Aislamiento Viral en Cultivo Celular A partir de los tejidos positivos a la técnica RT-PCR, se realizo el cultivo celular. Este, se llevo a cabo en la sala de incubación de la Unidad de Virología, en donde, se utilizaron células RK-13 suministradas por la Unidad de Cultivo celular. Las células, llegaron a la Unidad de Virología en placas de cultivo celular de 12 pocillos, más un frasco con 10 mL de medio esencial mínimo Eagle´s (MEM), suplementado con 10% de suero fetal bovino, 10.000 UI/mL de penicilina (1%), 10.000 µg/mL de estreptomicina (1%), y 25 µg/mL de amfotericina B (1%). Las células, listas para ser inoculadas presentaron una confluencia de aproximadamente un 80%. Antes de comenzar éste procedimiento, la placa fue rotulada con las muestras que se utilizaron en cada pocillo, número de pasajes y fecha de inoculación. A partir de los tejidos positivos, se extrajo 1gr de raspado desde la superficie del órgano, la cual fue homogeneizada en un mortero junto con MEM. El resultado, se extrajo en tubos Falcon® 45ml para posteriormente ser centrifugados a 5000rpm durante 20 minutos, el sobrenadante es pasado por filtros de membrana para jeringa de 0.45µm (gyro Disc® Orange Scientific). Este filtrado se inoculo en células RK-13, las que se fueron cultivadas como mínimo 1 hora a 37º C y con una saturación de CO2 5% y un 95% humedad. El inóculo se realizo en duplicado con distintas volúmenes de 50µL, 100µL y 200 µL del filtrado. Una vez terminada la incubación, se retiro el sobrenadante y fue restituido por 800 µL de MEM, posterior a esto las células fueron incubadas en las mismas condiciones antes mencionadas por un periodo de 5 a 7 días, las cuales fueron observadas todos los días para determinar efecto citopático. Las muestras que se consideraron positivas fueron 14 aquellas que presenten un 75% de reducción en comparación con las células control. RT-PCR Contra ORF5 Este procedimiento se realizo con muestras positivas a cultivo celular y muestras de tejido positivas a la técnica de RT-PCR, en caso de los virus que no pudieron replicarse en cultivo celular. Se utilizo el método de extracción de ARN antes mencionado. Además de amplificar los segmentos ORF6 y ORF7 se incluyo el segmento ORF5. Para la realización de la RT-PCR convencional contra el segmento ORF5 los partidores a utilizar amplificaron 808pb de la región ORF5 de AVE. 11253: 5’- GACGGATCGCGGCGTTATTG – 3’ Posición: 11253 - 11272 (Stadejek et al., 1999) RORF6: 5’- GCAGCCAAAAGCACAAAAGC – 3’ Posición: 12105 – 12124 (OIE, 2013) Para el desarrollo de la técnica se utilizo el kit comercial QIAGEN OneStep RTPCR, formando una mezcla maestra, la cual contiene: 5 μL de 5x buffer PCR, 0,8 μL de dNTPs (10Mm), 0,6 μL de MgCl2 (50Mm), 0,3 μL de Inhibidor de Rnasa (40 U/μL), 0,8 μL de cada partidor (20pmol/μL), 1 μL de Enzima MixQuiagen, 7,7 μL de RNAase free wáter, 8 μL de templado ARN, completando un volumen total de 25 μL. . Posteriormente se procedió a amplificar el segmento ORF5 del AVE mediante el uso de un termociclador (Applied Biosystems® 2720 ThermalCycler). Para amplificar el material genético se realizo primero un proceso de transcripción reversa a 50°C durante 30 minutos. A continuación, una desnaturalización inicial a 95°C por 15 minutos, posteriormente 35 ciclos que constan de una fase de desnaturalización a 94°C por 45 segundos, una fase de apareamiento a 60°C por 60 segundos y una fase de elongación a 72°C por 90 segundos. Por último, la 15 muestra fue sometida a una fase de elongación final a 72°C por 10 minutos, obteniéndose un producto de 808pb. 

Purificación de ADN Los productos que midieron 808pb en el RT-PCR contra ORF5, 193pb en el RTPCR contra ORF6 y 316pb en el RT-PCR contra ORF7 fueron extraídos desde el gel de agarosa los que posteriormente fueron purificados mediante el uso de un kit comercial (QIAquick® Gel Extraction Kit) siguiendo el protocolo recomendado por el fabricante. Finalmente, se medio la cantidad de ADN (ng/μL) y pureza (razón A260/280) del ADN purificado en un espectrofotómetro (Nanodrop® ND-1000 Spectophotometer). Análisis filogenético de las secuencias en estudio Los productos purificados, fueron enviados para el proceso de secuenciación a la empresa Macrogen Inc. Fue enviado el ADN purificado junto a 1 par de partidores, correspondientes a cada segmento amplificado: ORF5, ORF6 y ORF7. El análisis filogenético molecular de las secuencias nucleotídicas obtenidas por RT-PCR, se realizo usando el programa MEGA de análisis bioinformático. Para ello, las secuencias nucleotídicas obtenidas se alinearon para cada una de las regiones por separado mediante el programa ClustalW® 2.0 (Larkin et al., 2007). Una vez, realizado el alineamiento múltiple, se procedió a la construcción de árboles filogenéticos, incluyendo cada secuencia analizada mediante el programa MEGA® 6.0 (Mishra et al., 2007). Se utilizo para esto el método de “NeighborJoining” (Saitou y Nei, 1987), tomando como modelo de sustitución de bases el método de dos parámetros de Kimura (1980) y para probar la fuerza del análisis y la significancia del ordenamiento se realizo un “bootstrap” de 1000 réplicas. 16 Protocolo de Bioseguridad y procedimientos a seguir durante la ejecución del estudio. Todos estos procedimientos, fueron ejecutados bajo las normas de bioseguridad que tendieron a contener e impedir la diseminación al medio ambiente de agentes patógenos que se manipulen dentro de la Unidad de Virología. Con respecto, a las personas que visiten la Unidad, deben hacer lectura del instructivo e identificarse antes de ingresar al laboratorio. Toda persona que ingrese al laboratorio hará cambio total de ropa y para su salida deberá realizar una ducha de descontaminación. Con respecto al personal, la manipulación de las muestras en el estudio experimental fue realizada por personal técnico debidamente capacitado en el manejo de muestras biológicas, el cual se protegió con delantales, guantes, gorros y anteojos de plástico. Para realizar la desinfección y contención se utilizo Virkon®, alcohol 70° y alcohol yodado. En cuanto al equipamiento utilizado, el laboratorio cuenta con presión negativa en todas sus salas y de cámaras de flujo laminar. Además, la unidad cuenta con autoclaves en donde se esterilizan todos los materiales que son posteriormente sacados y llevados a la sala de lavado. 

 V. RESULTADOS

 A partir de las muestras procesadas del protocolo 7634 y 7635, los tejidos correspondientes a conducto deferente, próstata y vesícula seminal del protocolo 7634, fueron positivos para la técnica RT-PCR para los segmentos ORF6 y ORF7. En tanto, la muestra de conducto deferente correspondiente al protocolo 7634, fue positiva a la técnica RT-PCR para el segmento ORF5 (figura 1). Figura 1. Gel de agarosa al 1,5%. Carril 1 y 2: muestras positivas a AVE, ORF5; Carril 3 y 4: Control negativo; Carril 5: Control positivo a AVE, ORF5; carril 6 Ladder. Estas muestras lograron ser secuenciadas y posteriormente editadas, obteniendo una secuencia parcial para el segmento ORF5 de 630 pares de bases (pb); ORF6 de 193pb y ORF7 de 316pb. Estos segmentos, fueron analizados por el programa BLAST (NCBI), el cual indicó que pertenecían a AVE con una identidad del 77% para la secuencia de ORF5; 85% para ORF6; 91% para ORF7, los que para este estudio será identificada como cepa Atacama. Posteriormente, se procedió a compararlos con cepas descritas en la literatura, para los segmentos ORF7 y ORF6 se utilizaron las cepas de referencia observadas en la Tabla 1. 18 Tabla 1. Cepas de referencia para AVE utilizadas para comparar el segmento ORF6 y ORF7 Cepa Origen Nº GenBank Grupo Bucyrus USA DQ846750 NA VBS53 USA U81013 NA ARVAC USA U81019 NA ATCC USA U81020 NA CDN2 (CAN8) Canadá U81021 NA CW01 USA AY349168 EU-2 CW96 USA AY349167 EU-2 F15 Francia EF492553 EU-2 F10 Francia EF492548 EU-2 F9 Francia EF492547 EU-1 F5 Francia EF492543 NA G1 Gran Bretaña AF118777 EU-1 P1 Polonia AF118775 EU-1 Donde se indica nombre de la cepa, origen, número correlativo en base de datos GenBank y grupo al que pertenecen: Norteamericana (NA), Europeo-1 (EU-1) y Europeo- 2 (EU-2). Bucyrus, VBS53, ATCC, CDN2 (Patton et al., 1999); CW96, CW01 (Balasuriya et al., 2004b); ARVAC, F15, F10, F9, F5 (Zhang et al., 2007); G1, P1 (Balasuriya et al., 1999). Para el segmento parcial de ORF7, se evidenció una similitud nucleotídica con un rango que varía entre 86,0% (cepas Bucyrus, VBS53, ATCC, CDN2) y 87,2% (cepa F10). En tanto, la similitud aminoacídica varió desde 92,7% (cepa ARVAC) a 95,9% (cepas CW01, CW96, F9, G1 y P1). Para el caso de la cepa de referencia Bucyrus, se evidencia un 86,0% de similitud nucleotídica y un 93,8% de similitud aminoacídica (Figura 2). 19 Figura 2. Porcentaje de similitud de nucleotídica y aminoacídica del segmento parcial de ORF7 de la cepa Atacama con las distintas cepas de referencia de AVE. *comparación nucleotídica; **comparación aminoacídica. 

 En el árbol filogenético del segmento ORF7 de AVE, se evidencian 3 grupos filogenéticos: Norteamericano, formado por las cepas VBS53, ATCC, Bucyrus, ARVAC, F5, CDN2 (CAN86); subgrupo Europeo-1, formado por las cepas F9, G1 y P1; subgrupo Europeo-2, formado por las cepas CW01, CW96, F15 y F10; y la cepa Atacama, la cual se encuentra más alejada del resto de las cepas de referencia de AVE (Figura 3). Figura 3. Árbol filogenético del segmento parcial ORF7 de AVE. Cepas del grupo Norteamericano (rojo), cepas del subgrupo Europeo-1 (azul), cepas del subgrupo Europeo-2 (amarillo), cepa Atacama (verde). Al comparar el segmento parcial de ORF6, se observó que hay una similitud nucleotídica de entre 71,9% y 79,8%, siendo la cepa ARVAC la que se encuentra más distante nucleotídicamente de la cepa Atacama y la cepa F9 la más cercana, en tanto la cepa de referencia Bucyrus presenta un 73,1% de similitud nucleotídica. La similitud aminoacídica varía de un 84,8% (cepas ARVAC, ATCC y CDN2) a un 88,4% (cepas Bucyrus, VBS53, ATCC, F15, F10, F9, F5, G1 y P1) (Figura 4). 21 Figura 4. Porcentaje de similitud de nucleotídica y aminoacídica del segmento parcial de ORF6 de la cepa Atacama con las distintas cepas de referencia de AVE. *comparación nucleotídica; ** comparación aminoacídica. 22 En el árbol filogenético de ORF6 de AVE, se observan 3 grupos: Norteamericano, en el que se encuentran la cepa de referencia Bucyrus, junto a las cepas ARVAC, CND2, ATCC, VBS53 y F5. El subgrupo Europeo-1, con cepas P1, F9 y G1; subgrupo Europeo-2, con cepas F10, F15, CW01, CW96 y la cepa Atacama, esta se encuentra más alejada filogenéticamente del resto de las cepas de referencia de AVE(Figura 5). Figura 5. Árbol filogenético del segmento parcial ORF6 de AVE. Cepas Norteamericanas (rojo), cepas del subgrupo Europeo-2 (amarillo), cepas del subgrupo Europeo-1 (azul), cepa Atacama (verde). Para el segmento parcial de ORF5, de 630pb, fue comparado con secuencias obtenidas desde la base de datos de GenBank (tabla 2). 23 Tabla 2. Cepas de referencia para AVE utilizadas en la comparación del segmento ORF5. Cepa Origen Nº GenBank Grupo Bucyrus USA DQ846750 NA P1 Polonia AF118775 EU-1 A1 Austria U46952 EU-1 ARVAC USA U81019 NA CA97 USA AF118783 EU-2 CDN2 (CAN86) Canadá U81021 NA CW96 USA AY349167 EU-2 ATCC USA U81020 NA I8 (1489V-96) Italia AF099829 EU-1 F15 Francia EF492553 EU-2 F10 Francia EF492548 EU-2 F9 Francia EF492547 EU-1 F5 Francia EF492543 NA G1 Gran Bretaña AF118777 EU-1 LP02/R Argentina DQ435440 EU-1 RSA3 Sudáfrica AY453334 EU-1 J1-931125 Sudáfrica AY956596 EU-2 VBS53 (USA1) USA U81013 NA Donde se indica el nombre de la cepa, origen, número correlativo en base de datos GenBank y grupo al que pertenecen: Norteamericana (NA), Europeo-1 (EU-1) y Europeo- 2 (EU-2). Bucyrus, CDN2, ATCC, VBS53 (Patton et al., 1999); P1, A1, CA97, G1 (Balasuriya et al., 1999); CW96 (Balasuriya et al., 2004b); I8 (Stadejek et al., 1999); ARVAC, F5, F9, F10, F15 (Zhang et al., 2007); LP02/R (Echeverria et al., 2007); RSA3 (Guthrie et al., 2003); J1-931125 (Stadejek et al., 2006) 24

 Al observar la similitud entre las secuencias aminoacídicas con la cepa de referencia Bucyrus (grupo Norteamericano), ésta fue tan sólo de un 64,9%. En tanto, al comparar con las otras cepas de referencia de AVE se observó una similitud que varía entre un 62% y un 78,6%. Del grupo Norteamericano la cepa que tuvo mayor similitud nucleotídica fue CND2 (CAN86) que presentó un 68,5% de homología nucleotídica, en este grupo se encuentra también la cepa vaccinal ARVAC que presentó tan solo un 62,0% de similitud nucleotídica, siendo de las cepas analizadas la que se encuentra más alejada filogenéticamente. En tanto en el grupo Europeo-1, la cepa P1 presentó un 68,0% de similitud nucleotídica, dentro de este grupo también se encuentra la cepa Argentina LP02/R que presentó una similitud aminoacídicas de un 66,7% y una cepa aislada en burros Italianos I8 (1489V-96) con un 67,0% de similitud. En tanto el grupo Europeo2, la cepa J1- 931125 fue la que presento mayor similitud nucleotídica con la cepa Atacama con un 78,6% de similitud. Aminoacídicamente hay una variación de entre 77,7% (cepa vaccinal ARVAC) y 93,1% (cepa J1-931125). En tanto con la cepa de referencia Bucyrus hay una variación de un 81,4% (Figura 6) 25 Figura 6. Porcentaje de similitud de nucleotídica y aminoacídica del segmento parcial de ORF5 de la cepa Atacama con las distintas cepas de referencia de AVE. *comparación nucleotídica; ** comparación aminoacídica. 26 En el árbol filogenético del segmento ORF5 de AVE se observan 3 grupos los que corresponden al grupo Norteamericano, subgrupo Europeo-1 y subgrupo Europeo- 2, dentro de este grupo se encuentran las cepas Atacama y J1-931125, ambas de origen asnal, las que se encuentran filogenéticamente mas alejadas del resto de las cepas de referencia para AVE (figura 7). Figura 7. Árbol Filogenético del segmento parcial ORF5 de AVE. Cepas del grupo Norteamericano (rojo), cepas del subgrupo Europeo-1 (azul), cepas del subgrupo Europeo-2 (amarillo), cepas Asnales del subgrupo Europeo-2 (verde). La cepa atacama presentó mayor similitud tanto aminoacídica como nucleotídica con la cepa J1-931125, esta pertenece al subgrupo europeo 2. Por ello se 27 comparó con distintas cepas pertenecientes a este subgrupo a nivel del segmento ORF5 (Tabla 3). Tabla 3. Cepas de referencia para AVE correspondientes al subgrupo Europeo-2, para la comparación con la cepa Atacama a nivel del segmento ORF5. Cepa Origen Nº GenBank Grupo CA97 USA AF118783 EU2 CW96 USA AY349167 EU2 F15 Francia EF492553 EU2 F10 Francia EF492548 EU2 J1-931125 Sudáfrica AY956596 EU2 S2 Suecia AY453340 EU2 RSA1 Sudáfrica AY453332 EU2 H13 Hungría AY453298 EU2 A9 Austria AY453282 EU2 GB3 (96-7982) Gran Bretaña AF099846 EU2 N3 (NEAV3) Noruega AF099837 EU2 I4 (470VE1-95) Italia AF099825 EU2 D1 (W887) Alemania AF099817 EU2 DK97-5 Dinamarca AF247543 EU2 Se indica el nombre de la cepa, origen, número correlativo en base de datos GenBank. CA97 (Balasuriya et al., 1999); CW96 (Balasuriya et al., 2004b); F15, F10, DK97-5 (Zhang et al., 2007); J1-931125 (Stadejek et al., 2006); S2, RSA1, H13, A9 (Mittelholzer et al., 2006); GB3 (96-7982), N3 (NEAV3), I4 (470VE1-95), D1 (W887) (Stadejek et al., 1999).

 Las similitudes aminoacídicas y nucleotídica de la cepa Atacama con el resto del subgrupo Europeo-2, al igual que en la figura 6 se evidencia que la mayor cercanía es con la cepa J1-931125, esta representa un cluster de cepas asnales sudafricanas además de las cepas J25-941109-3 (Stadejek et al., 2006) y RSA1 (Guthrie et al., 2003), éstas presentan una similitud nucleotídica de un 78,8% y 28 una similitud aminoacídica de un 93,1% con la cepa Atacama. En tanto, la cepa más distante nucleotídicamente es la cepa H13 con un 66,1% de similitud y 83,5% de similitud aminoacídica, seguidas por F10 y F15 con 66,3% y 82,7%; CA97 con 66,7% y 83,5%; D1 con 66,9% y 82,0%; GB3 con 67,3% y 83,5%; NEAV3 con 67,4% y 83,5%; CW96 con 68,0% y 84,2%; I4 con 68,1% y 85,6%; DK97-5 con un 68,3% y 86,3%; A9 con un 68,3% y 84,2% de similitud aminoacídica y nucleotídica respectivamente (Figura 8). 29 Figura 8. Similitud nucleotídica y aminoacídica del segmento ORF5 de la cepa Atacama con las cepas de referencia del subgrupo Europeo-2. *comparación nucleotídica; **comparación aminoacídica. 30 En el árbol filogenético, del subgrupo Europeo-2 se observan 2 grupos formados las cepas de referencia de AVE de origen equino, alejadas de estas las cepas de referencia de origen asnal junto con la cepa Atacama. La cepa RSA1 fue aislada desde equino, pero pertenece al cluster de cepas aisladas de burros en Sudáfrica (Figura 9). Figura 9. Árbol filogenético del segmento ORF5 de las cepas de referencia de AVE pertenecientes al subgrupo Europeo-2. Cepas de origen equino (amarillo), cepas de origen asnal (verde) Al realizar el análisis del segmento parcial de ORF5 de la cepa Atacama con la cepa de referencia Bucyrus, se observaron 128 cambios de nucleótidos a lo largo de todo el segmento ORF5 (Figura 10, Apéndice). Éstos cambios generaron 28 variaciones aminoacídicas a nivel de la proteína GP5 en las posiciones: 61 corresponde a el epítopo neutralizante B que se encuentra en la zona variable V1 (61 – 121aa); cambios en posición 73, 85, 89 y 90 corresponden al epítopo 31 neutralizante C (67 - 90aa) en la zona V1; cambios en el aminoácido 101 corresponden al epítopo neutralizante D (98 - 106aa) en la zona V1; cambios en posición 136 corresponden a la zona conservada C2 (122 – 140); cambios de aminoácidos en la posición 141, 145. 151, 154, 158, 166, 167, 170, 173, 174, 175, 177 y 178, corresponden a la zona variable V2 (141 – 178aa), cambios en la posición 199, corresponden a la zona conservada C3; cambios en aminoácidos posición 207, 211, 214 y 220 corresponden al sector variable V3 (202 – 222aa). En la zona V1, se evidenciaron 6 cambios aminoacídicos, en V2 se evidencian 13 cambios y en zona V3, 4 cambios aminoacídicos. En tanto en las zonas conservadas C1 y C3 se observa 1 cambio aminoacídico por cada zona (Figura 11, Apéndice). En el segmento parcial ORF6 se evidenciaron 37 cambios nucleotídicos (Figura 12, Apéndice). Estos se tradujeron en 7 cambios aminoacídicas en la proteína M (Figura 13, Apéndice). En el segmento parcial ORF7 los cambios nucleotídicos fueron 38 (Figura 14, Apéndice). Estos generaron 6 cambios aminoacídicas a nivel de la proteína N (Figura 15, Apéndice). Además del estudio filogenético, se realizo también aislamiento viral en cultivo celular. Las muestras positivas a la técnica RT-PCR, Conducto Deferente, Próstata y Vesícula Seminal, de estas se logro realizar el cultivo en solo una de ellas correspondiente a la muestra de Conducto Deferente. Esta evidenció efecto citopático a partir del quinto día post-inoculación, el cual se evidencia por una disminución del tapiz celular y circularización de las células. Esto fue confirmado por la técnica RT-PCR (Figura 16).Figura 16: Cultivo celular en células RK-13 (40x) 7 días post-inoculación viral. A: control Negativo. B: células infectadas con AVE.  

VI. DISCUSION

 El virus de la arteritis viral equina genera pérdidas en la producción equina por aborto y reabsorción embrionaria en yeguas e infección persistente en machos (Balasuriya et al., 2014). En Chile, solo se implementaron medidas de mitigación luego del brote en Argentina del año 2010, dictándose la resolución exenta Nº 4615 (2010) para tomar medidas en el ingreso de equinos desde argentina y la pesquisa de los animales que han tenido contacto con equinos o semen de animales que provengan del extranjero, encontrándose dos casos sospechosos positivos a serología, los cuales se mantuvieron en cuarentena para confirmación del diagnostico (SAG, 2010). La Esta investigación efectuada en este trabajo corresponde al primer aislamiento y análisis filogenético de AVE realizado en Chile. Para el análisis filogenético de ORF5, fue posible obtener una secuencia parcial de un tamaño de 630pb, Esta secuencia es la menos conservada dentro del genoma de AVE, razón por la que este segmento es ampliamente utilizado para la clasificación filogenética de AVE y permite discriminar los distintos grupos y subgrupos (Zhang et al., 2007 ). La cepa Atacama, se encuentra muy distante genéticamente de la cepa de referencia Bucyrus con una similitud nucleotídica de 64,9% y una similitud aminoacídica de un 81,4%, lo que la alejaría del grupo Norteamericano al que pertenece Bucyrus. Además, presentó mayor cercanía filogenética con la cepa J1- 931125 (Stadejek et al., 2006), con una similitud nucleotídica de 78,6% y una similitud aminoacídica de 93,1%. Ésta cepa se encuentra muy alejada de los grupos filogenéticos de AVE, pero presentaría cierta cercanía con el subgrupo Europeo-2, donde fue clasificada (Zhang et al., 2007). Con estos antecedentes se clasificaría a la cepa chilena dentro de este subgrupo. El grupo filogenético Norteamericano, presenta cepas distribuidas por Norteamérica, Europa y Oceanía. Éste, siendo conformado por aislados de équidos de las regiones de Canadá, Estados Unidos, Nueva Zelanda, Países 34 Bajos (NL1), Gran Bretaña (GB3)(Stadejek et al., 1999), Hungría (H170S, H172S) (Hornyak et al., 2005), Noruega, Dinamarca (Mittelhozer et al., 2006), las cepas de laboratorio VBS53, ATCC, Bucyrus y la cepa vaccinal ARVAC (Stadejek et al., 1999; Mittelholzer et al., 2006; Zhang et al., 2007; Mertz et al., 2010). El subgrupo Europeo-1, está distribuido por Europa principalmente, compuesto por cepas de Austria, Francia, Italia, Alemania, Gran Bretaña, cepas italianas aisladas desde burros, USA8 y USA18 (Stadejek et al., 1999; Hornyak et al., 2005), Hungría, Dinamarca, Qatar (Mittelholzer et al., 2006),Polonia (Larska y Rola 2008; Surma-Kurusiewicz et al., 2013) cepas aisladas del brote en Estados Unidos del año 2006 y 2007 (Zhang et al., 2010), cepas aisladas en Argentina (Mertz et al., 2010) y las cepas aisladas desde caballos Hucul de Polonia (Rola et al.,2011). Las cepas presentes en el subgrupo Europeo-2 se han aislado en Francia, Italia, Alemania, Noruega (Stadejek et al., 1999; Surma-Kurusiewicz et al., 2013), CW96 y CW01 aislados en Estados Unidos (Balasuriya et al., 2004b), Países Bajos, Dinamarca, Suecia, Hungría, USA52 en Estados Unidos (Mittelholzer et al., 2006), Polonia (Larska y Rola 2008) y Sudáfrica, esta ultima presenta 2 cluster compuesto por cepas aisladas desde potros lipizzanos (Guthrie et al., 2003; Mertz et al., 2010) y otra por asnales a la que pertenecen 2 aislados desde equinos (Stadejek et al., 2006; Guthrie et al., 2003). Lo que demuestra, la posibilidad de que las cepas de asnales silvestres puedan transmitirse libremente a équidos domésticos. No se han reportado brotes de estas cepas en Sudamérica. Argentina, en los casos de AVE observados se han caracterizado cepas como la LP02/R, que presenta una homología nucleotídica de 66,7% y 82,1% aminoacídica con la cepa Atacama y una similitud nucleotídica de 82,3% y aminoacídica de 89,1% con la cepa Bucyrus. LP02/R pertenece a un mismo cluster junto con las cepas argentinas LP01, LP02/P, LP02/C (Echeverría et al., 2007) RO-LP-ARG, RZ-LP-ARG y KB-LP-ARG (Mertz et al., 2008), siendo todas estas clasificadas dentro del grupo Europeo-1 (Mertz et al., 2010). Según la OIE, no se reportan casos de AVE en animales silvestres, en Perú, Bolivia y Argentina (WAHIS, 2015c), pero ésto no podría descartarse por completo debido a la evidencia 35 demostrada con el reciente descubrimiento de la cepa en Chile. Estos son los únicos reportes, lo que podría deberse a que no existen estudios acerca del tema en el continente. Para el segmento ORF7 que codifica para la proteína N (Nucleocápside), es uno de los segmentos más conservados del virus. Corresponde al 30% de las proteínas que conforman el virus. Presenta un sitio N-terminal (1-47 aa), que es el menos conservado y se cree que interactúa con el ARN en el ensamblaje de la Nucleocapside. El sitio C-terminal (49-110 aa) forma un dímero que consiste en una estructura en beta-plegada flanqueada por una alfa-hélice (Snijder et al., 2013; Balasuriya et al., 2013). La cepa Atacama presenta mayor homología nucleotídica en el segmento ORF7 con la cepa F10, 87,2% la que pertenece al subgrupo Europeo-2. Esto no se vio reflejado a nivel aminoacídico, ya que tuvo mayor similitud con las cepas CW01, CW96 pertenecientes al subgrupo Europeo- 2, las cepas F9, G1 y P1 corresponden al subgrupo Europeo-1, estas presentaron una similitud de un 95,9%. Al observar la cepa dentro del árbol filogenético del segmento ORF7, Atacama se encuentra alejada filogenéticamente del resto de las cepas en estudio. El segmento ORF6 codifica para la proteína M, esta es la proteína de membrana más conservada y junto con la proteína GP5 forman el complejo mayor de membrana. Esta proteína carece de sitio de N-glicosilacion y presenta un sitio de unión GP5 mediante un puente disulfuro (S-S) el que se encuentra en posición Cys 8 (M) y Cys 34 (GP5), esta proteína ayuda a plegar la proteína GP5 y de esta forma presentar los epítopes neutralizantes (Balasuriya et al., 2013). De las cepas de referencia analizadas, presentaría mayor similitud con la cepa F9, un 79,8 y 88,4% de similitud nucleotídica y aminoacídica respectivamente, que corresponde al subgrupo Europeo-1. Al observar el árbol filogenético de ORF6 La cepa Atacama se observa muy alejada del resto de las cepas de referencia en estudio, lo que podría deberse a que es una cepa de origen asnal. El segmento ORF5 codifica para la proteína GP5, que es la proteína de envoltura más abundante de AVE (Snijder et al., 2013), presentando mayor variabilidad 36 dentro de las proteínas del virus, ya que ésta, presenta los epítopes neutralizantes y está en constante presión por el sistema inmune del hospedador estimulando la producción de anticuerpos neutralizantes (Balasuriya et al., 2013). Presenta 2 sitios N-glicosilacion, Asn56 y Asn 81. Un ectodominio que contiene 95 aminoácidos (aa) en donde del aa 1 al 18 corresponde al sitio N-terminal. Los anticuerpos monoclonales neutralizantes contra AVE se unen al ectodominio de GP5 (19-115 aa). Esta proteína contiene 3 zonas conservadas en las que se encuentra C1 (19-60), C2 (122-140) y C3 (179-201) y 3 zonas variables V1 (61- 121), V2 (141-178) y V3 (202 -222). Además, presenta 4 sitios principales de neutralización: A (49 aa), B (61aa), C (67-90aa) y D (98-106aa). En donde A se encuentra dentro de C1 y desde B a D se encuentran en la zona hipervariable V1 (Balasuriya et al., 1995a). A nivel del segmento ORF5, la cepa Atacama presenta mayor similitud nucleotídica (78,6%) y aminoacídica (93,1%) con la cepa J1- 931125, perteneciente a un clúster conformado por cepas aisladas en Sudáfrica desde asnales: J2-931125, J3-931209, J4-931209, J6-940309, J7-931125 (Stadejek et al., 2006), y desde caballos: J25-941103-3 (Stadejek et al., 2006) y RSA1(Guthrie et al., 2003). En contraste, las cepas 1489V-96 (I8) y 3308V-96 (I9) (Stadejek et al., 1999) fueron aisladas desde burros en Italia, pero éstas no presentan relación filogenética con las cepas Atacama y J1-931125, ya que presenta una cercanía nucleotídica de 81,3% y aminoacídica de 89,8% con la cepa de referencia, clasificándolas dentro del subgrupo Europeo-1. Se descartaría el ingreso de la cepa desde Argentina, ya que presenta una considerable divergencia filogenética, por lo que se postula que en Chile existe una cepa ancestral, la que se ha mantenido circulante dentro de la población de burros de la Región como una infección endémica. El uso de los segmentos ORF6 y ORF7 no serían confiables para la clasificación filogenética de las cepas de AVE dentro de un cluster, ya que al ser segmentos más conservados tienen menos variaciones genéticas (Larska y Rola 2008; Rola et al., 2013), lo que no permite discriminar entre cepas de cercanas filogenéticamente. En el caso de cepas que presentan mayor distancia genética, presenta cierta fiabilidad, ya que se conservan los grupos filogenéticos de AVE, 37 como sucede en este estudio. En el caso del segmento ORF5, por su alta variabilidad genética es más confiable para realizar clasificación filogenética, ya que nos permite determinar con mayor certeza la identidad viral (Stadejek et al., 1999; Mittelholzer et al., 2006; Zhang et al., 2007; Larska y Rola 2008). Para el diagnóstico de la enfermedad la prueba estándar utilizada por la OIE es la seroneutralización, para ello se utiliza la cepa Bucyrus como antígeno (OIE, 2013). Esta cepa tiene una divergencia de un 35,1 % a nivel nucleotídico, lo que se traduce en una variación aminoacídica del 18,6% para la proteína GP5. Esta proteína es la principal estimuladora del sistema inmune, ya que es la que está en contacto con éste y es contra la que se presentan los anticuerpos neutralizantes. Con estos datos se recomendaría evaluar la capacidad de diagnóstico en Chile, mediante el uso de la cepa Bucyrus para la infección con la cepa Atacama, ya que la técnica debido a sus diferencias genéticas podría presentar menor sensibilidad, lo que generaría un considerable número de individuos falsos negativos. Sería una opción a considerar, implementar otra técnica diagnostica con la cepa presente en el país, como se realizó en Argentina a través del desarrollo de un test de ELISA propio (Mertz et al., 2014). En el caso de la cepa vaccinal ARVAC, que es mundialmente utilizada para la inmunización de contra AVE, presento una similitud nucleotídica de un 62,0% y aminoacídica 77,7% con respecto a la cepa Atacama. En el caso de la inmunidad otorgada por la vacuna, sería recomendable evaluar la protectividad cruzada de ésta, ya que presenta una variación mayor al 20% con la cepa Atacama en relación a la proteína GP5, como se mencionó anteriormente, ésta es proteína la que estimula la respuesta inmune contra AVE, por ello si se quisiera controlar con vacunación la opción más válida sería sintetizar vacunas con la cepa actuante en Chile, ya que en el caso de erradicación de la enfermedad no es recomendable vacunar. En este estudio además se logro aislar la cepa Atacama en cultivo celular, este aislado podría utilizarse para estudios futuros acerca del diagnóstico y la 38 elaboración de vacunas con el fin de un control más acertado de la enfermedad y erradicación de esta. Los antecedentes planteados en la hipótesis hacen suponer que la cepa Atacama, es distinta a las presentes en caballos, sería una cepa asnales silvestres nueva de no descrita en la literatura. Existe evidencia científica de que estas cepas silvestres como es el caso de la cepa Chilena, pueden infectar a équidos domésticos (Guthrie et al., 2003; Stadejek et al., 2006), lo que representaría un potencial riesgo para la población de equinos del país. 39

 VII. CONCLUSIONES

 1. Se logóaislar el virus de la arteritis viral equina a partir de las muestras serológicamente positivas provenientes de la Región de Atacama. 2. Fue posible realizar diagnostico de arteritis viral equina, de los aislados celulares mediante la técnica RT-PCR, para los segmentos ORF6 y ORF7. 3. A través de la secuenciación genética de los segmentos ORF5, ORF6 y ORF7 fue posible caracterizar una cepa actuante en los aislados de arteritis viral equina. 4. La cepa Chilena pertenecería al subgrupo Europeo-2 de arteritis viral equina, la que sería una novel cepa no descrita anteriormente en la literatura

.VIII. REFERENCIAS BIBLIOGRAFICAS

 1. Asagoe T, Y Inaba, E Jusa, M Kouno, K Uwatoko, Y Fukunaga. 1997. Effect of heparin on infection of the cells by Equine Arteritis Virus. J. Vet. Med. Sci. 59 (8): 727 – 728. 2. Balasuriya U, N MacLachlan, A de Vries, P Rossitto, P Rottier. 1995a. Identification of a Neutralization site in the major envelope glycoprotein (Gl) of Equine Arteritisvirus. Virology. 207: 518 – 527. 3. Balasuriya U, P Timoney, W McCollum, J MacLachlan. 1995b. Short Communication: Phylogenetic Analysis of Open Reading Frame 5 of Field Isolates of Equine Arteritis Virus and Identification of Conserved and Nonconserved Regions in the GL Envelope Glycoprotein. Virology. 214: 690 – 697. 4. Balasuriya U, J Patton, P Rossitto, P Timoney, W McCollum, N McLachlan. 1997. Neutralization Determinants of Laboratory Strains and Field Isolates of Equine Arteritis Virus: Identification of Four Neutralization Sites in the Amino-Terminal Ectodomain of the GL Envelope Glycoprotein. Virology. 232: 114 – 128. 5. Balasuriya U, J Hedges, S Nadler, W McCollum, P Timoney, N MacLachlan. 1999. Genetic stability of Equine arteritis virus during horizontal and vertical transmission in an outbreak of equine viral Arteritis. Journal of General Virology. 80: 1949 – 1958. 6. Balasuriya U, C Leutenegger, J Topol, W McCollum, P Timoney, N MacLachlan. 2002. Detection of Equine Arteritis Virus by real-time TaqMan® reverse transcription-PCR assay. Journal Virology Methods. 101: 21 – 28. 41 7. Balasuriya U, J Dobbe, H Heidner, V Smalley, A Navarrette, E Snijder, N MacLachlan. 2004a. Characterization of the neutralization determinants of Equine Arteritis Virus using recombinant chimeric viruses and site-specific mutagenesis of an infectious cDNA clone. Virology. 321: 235 – 246. 8. Balasuriya U, J Hedges, V Smalley, A Navarrette, W McCollum, P Timoney, E Snijder, N McLachlan. 2004b. Genetic characterization of Equine Arteritis Virus during persistent infection of stallion. Journal of General Virology. 85: 379 – 390. 9. Balasuriya U, Y Go, N MacLachlan. 2013. Equine Arteritis Virus. Veterinary Microbiology. 167: 93 – 122. 10.Balasuriya U. 2014. Equine Viral Arteritis. Vet. Clin. Equine. 30: 543 – 560. 11.Chung C, C Wilson, P Timoney, U Balasuriya, E Adams, D Adams, J Evermann, A Clavijo, K Shuck, S Rodgers, S Lee, T McGuire. 2013. Validation of an improved competitive enzyme-linked immunosorbent assay to detect Equine Arteritis Virus antibody. Journal of Veterinary Diagnostic Investigation. 25 (6): 727– 735. 12.de Vries A, E Chirnside, M Horzinek, P Rottier. 1992. Structural protein of Equine Viral Arteritis. Journal of Virology. 66 (11): 6294 – 6303. 13.de Vries A, M Horzinek, P Rottier, R de Groot. 1997. The Genome Organization of the Nidovirales: Similarities and Differences between Arteri-,Toro-, and Coronaviruses. Virology. 8: 33 – 47. 42 14. Decreto N º389 Exento. establece enfermedades de declaración obligatoria para la aplicación de medidas sanitarias y deroga decretos que indica. 21 Noviembre 2014. Santiago, Chile. 15.Del Piero F. 2000. Equine Viral Arteritis. Vet. Pathol. 37: 287 – 296. 16.Deshpande A, S Wang, M Walsh, T Dokland. 2007. Structure of the Equine Arteritis Virus nucleocapsid protein reveals a dimer – dimer arrangement. Acta Cryst. 63: 581-586. 17.Doll E, J Bryans, M Crowe, W McCollum. 1957. Isolation of a filterable agent causing Arteritis of horses and abortion by mares; its differentiation from the equine abortion (influenza) virus. Cornell Vet. 47 (1): 3 – 41. 18.Dunowska M, P Biggs, T Zheng, M Perrot. 2012. Identification of a novel nidovirus associated with a neurological disease of the Australian brushtail possum (Trichosurus vulpecula). Veterinary Microbiology. 156: 418 – 424. 19.Echeverria M, S Diaz, G Mertz, M Serena, C Panei, E Nosetto. 2007. Genetic typing of Equine Arteritis Virus isolates from Argentina. Virus Genes. 35: 313 – 320. 20.Firth A, J Zevenhoven-Dobbe, N Wills, Y Go, U Balasuriya, J Atkins, E Snijder, C Posthuma. 2011. Discovery of a small Arterivirus gene that overlaps the GP5 coding sequence and is important for virus production. Journal of General Virology.92: 1097 – 1106. 43 21.Fuentealba J. 2010. Informe de actividades de avance de vigilancia sobre Arteritis Viral Equina. pp: 1-14. Servicio Agricola y Ganadero, Subdepartamento de Vigilancia Epidemiológica, División de Protección Pecuaria. Santigo, Chile. 22.Glaser A, A de Vries, P Rottier, M Horzinek, B Colenbrander. 1996. Equine Arteritis Virus: A review of clinical features and management aspect. Vet Quart. 18: 95 – 99. 23.Glaser A, E Chirnside, M Horzinek, A de Vries. 1997. Equine Arteritis Virus. Theriogenology. 47: 1275 – 1295. 24.Go Y, R Cook, J Fulgencio, J Campos, P Henney, P Timoney, D Horohov, U Balasuriya. 2012. Assessment of correlation between in vitro CD3+ T cell susceptibility to EAV infection and clinical outcome following experimental infection. Veterinary Microbiology. 157: 220 – 225. 25.Gorbalenya A, L Enjuanes, J Ziebuhr, E Snijder. 2006. Nidovirales: Envolving the largest RNA virus genome. Virus Researsh. 117: 17 – 37. 26.Guthrie A, P Howell, J Hedges, A Bosman, U Balasuriya, M McCollum, P Timoney, N MacLachlan. 2003. Lateral Transmission on the Equine Arteritis Virus among Lipizzaner stallion in South Africa. Equine Vet. J. 35 (6): 596 – 600. 27.Holyoak G, U Balasuriya, C Broaddus, P Timoney. 2008. Equine Viral Arteritis: Current status and prevention. Theriogenology.70: 403 – 414. 44 28.Hornyak A, T Bakonyi, G Tekes, L Szeredi, M Rusvai. 2005. A novel subgroup among genotypes of Equine Arteritis Virus: genetic comparison of 40 strains. J. Vet. Med. 52: 112 – 118. 29.Hullinger P, I Gardner, S Hietala, G Ferraro, J MacLachlan. 2001. Seroprevalence of antibodies against equine Arteritis virus in horses residing in the United States and imported horses. JAVMA. 219 (7): 946 – 949. 30.Instituto Nacional de Estadísticas. 2014. Censo agropecuario y forestal 2007. [en línea] INE. http://www.ine.cl. [Consulta: 16 diciembre 2015]. 31.Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16 (2): 111 – 120. 32.Larkin M, G Blackshields, N Brown, R Chenna, P McGettigan, H McWilliam, F Valentin, I Wallace, AWilm, R Lopez, J Thomson, T Gibson, D Higgins. 2007. Clustal W and Clustal X versión 2.0.Bioinformatics. 23(21): 2947- 2948. 33.Larska M, J Rola. 2008. Molecular epizootiology of Equine Arteritis Virus Isolates from Poland. Veterinary Microbiology.127: 392 – 398. 34.Liu L, J Castillo-Olivares, N Davis-Poynter, C Baule, H Xia, S Belak. 2008. Analysis of ORFs 2b, 3, 4, and partial ORF5 of sequential isolates of Equine Arteritis Virus shows genetic variation following experimental infection of horses. Veterinary Microbiology. 129: 262 – 268. 45 35.McFadden A, P Pearce, D Orr, K Nicoll, T Rawdon, H Pharo, M Stone. Evidence for absence of Equine Arteritis Virus in the horse populations of New Zealand. New Zealand Veterinary Journal. 61(5): 300 – 304. 36.McLachland N, U Balasuriya, P Rossitto, P Hullinger, J Patton, W Wilson. 1996. Fatal experimental equine Arteritis virus infection of a pregnant mare: immunohistochemical staining of viral antigens. J. Vet. Diag. Invest. 8: 367 – 374. 37.Metz G, M Serena, S Díaz, M Echeverría. 2008. Caracterización de secuencias del virus de la Arteritis Equina obtenidas directamente de muestras de semen de equinos seropositivos. Analecta Veterinaria. 28 (2): 21 – 26. 38.Mertz G, G Martin, M Serena, S Gambaro, E Nosetto, M Echeverria. 2010. Extended phylogeny of the equine arteritis virus including South American sequences. Intervirology. 54: 30 – 36. 39.Mertz G, E Lorenzon, M Serena, S Corva, C Panei, S Diaz, E Cilli, M Echeverria. 2014. Development of a peptide ELISA for the diagnosis of Equine Arteritis Virus. Journal of Virological Methods. 205 : 3–6. 40.Mishra N, R Dubey, K Rajukumar, C Tosh, ATiwari, S Pitale, H Pradhan. 2007. Genetic and antigenic characterization of bovine viral diarrea virus type 2 isolated from Indian goats (Capra hircus). Veterinary Microbiology. 124: 340 – 347. 41.Mittelholzer C, T Stadejek, I Johansson, C Baule, I Ciabatti, D Hannant, D Paton, G Autorino, N Nowotny, S Belak.2006. Extended 46 phylogeny of Equine Arteritis Virus: division into new subgroups. J. Vet. Med. 53: 55 – 58. 42.Miszczak F, K Shuck, Z Lu, Y Go, J Zang, S Sells, A Vabret, S Pronost, G Fortier, P Timoney, U Balasuriya. 2011. Evaluation of two Magnetic-Bead-Based Viral Nucleic Acid Purification Kits and three Real-Time Reverse Transcription-PCR Reagent Systems in two TaqMan Assays for Equine Arteritis Virus detection in semen. Journal Of Clinical Microbiology. 49 (10): 3694 – 3696. 43.Moreira R, A García, V Moreno, J Valencia. 2014. Arteritis viral equina en Burros (Equus asinus) asilvestrados de la Región de Atacama, Chile. XVIII Congreso Chileno de Medicina Veterinaria. 01-02-03 diciembre 2014. Universidad de Chile. Facultad de Ciencias Veterinarias y Pecuarias. Santiago, Chile. 44.Organización Internacional de Epizootias. 2013. Arteritis Viral Equina. Capítulo 2.5.10. 45.Patton J, U Balasuriya, J Hedges, T Schweidler, P Hullinger, N MacLachlan. 1999. Phylogenetic characterization of a highly attenuated strain of Equine arteritis virus from the semen of a persistently infected Standardbred stallion. Archives of Virology. 144: 817 – 827. 46.Resolución Exenta Nº 4138. Establece zona de control sanitario de arteritis viral equina en población de Équidos. Diario Oficial de la República de Chile. 6 noviembre 2014. Santiago, Chile. 47.Resolución Exenta Nº 4615 (Derogado). Aplica medidas de mitigación en Forma Transitoria a la integración de équidos que indica al país. Diario Oficial de la República de Chile. 18 agosto 2010. 47 48.Rola J, M Larska, J Rola, S Belak, G Autorino. 2011. Epizootiology and phylogeny of Equine Arteritis Virus in Hucul horses. Veterinary Microbiology. 148: 402 – 407. 49.Rola J, W Socha, J Zmudzinski. 2013. Sequence analysis of ORFs 5, 6 and 7 of Equine Arteritis Virus during persistent infection of the stallion—A 7-year study. Veterinary Microbiology. 164: 378 – 382. 50.Saitou N, M Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic tres. Mol. Biol. Evol.4(4): p. 406- 425. 51.Servicio Agrícola y Ganadero. 2014. Minuta Arteritis Viral Equina (AVE) 52.Servicio Agricola y Ganadero. 2015. Lista de enfermedades de denuncia Obligatoria (EDO) al SAG. [pdf]. . [28 de Julio de 2015] 53.Snijder E, J Meulenberg. 1998. The molecular biology of Arteriviruses. Journal of General Virology. 79: 961 – 979. 54.Snijder E, K Marjolein, Y Fang. 2013. Arterivirus molecular biology and pathogenesis. Journal of General Virology.94: 2141 – 2163. 55.Stadejek T, H Bjôrklund, C Bascuñana, I Ciabatti, M Scicluna, D Amaddeo, W McCollum, G Autorino, P Timoney, D Paton, B Klingeborn, S Belak. 1999. Genetic diversity of Equine Arteritis Virus. Journal of General Virology.80: 691 – 699. 48 56.Stadejek T, C Mittelholzer, M Oleksiewicz, J Paweska, S Belak. 2006. Highly diverse type of Equine Arteritis Virus (EAV) from the semen of the south African donkey: Short communication. Acta Veterinaria Hungarica. 54 (2): 263 – 270. 57.Surma-Kurusiewicz K, S Winiarczyk, L Adaszek. 2013. Comparative analysis of ORF5 nucleotide sequences and amino acid sequences of the GP5 protein of Equine Arteritis Virus (EAV) detected in the semen of stallions from Eastern Poland. Research In Veterinary Science. 94: 361–367. 58.Timoney P, W McCollum. 1987. Equine Viral Arteritis. Can. Vet. J. 28: 693 – 695. 59.Timoney P, W McCollum. 1988. Equine Viral Arteritis – Epidemiology and control. Equine Veterinary Science.8 (1): 54 – 59. 60.Timoney P, W McCollum. 1996. Equine Viral Arteritis. Equine vet. Educ. 8 (2): 97 – 100. 61.Vaala W, A Hamir, E Dubovit, P Timoney, B Ruiz. 1992. Fatal, congenitally acquired infection with Equine Arteritis Virus in a neonatal Thoroughbred. Equine Vet. J. 24 (2): 155 – 158. 62.Wagner H, U Balasuriya, N MacLachlan. 2003. The serologic response of horses to Equine Arteritis Virus as determined by competitive enzyme-linked immunosorbent assays (c-ELISAs) to structural and non-structural viral proteins. CIMID. 26: 251 – 260. 49 63.WAHIS Interface. 2015. Country Information: Chile, Animal health situation: 2013. [En línea]. OIE World Animal Health Information System. . [Consulta: 28 diciembre 2015]. 64.WAHIS Interface. 2015b. Disease Control Measures, Country: Chile, Disease: Equine Viral Arteritis. [En línea]. OIE World Animal Health Information System. . [Consulta: 28 diciembre 2015]. 65.WAHIS Interface. 2015c. Disease distribution maps, equine viral Arteritis, 2013. [En línea]. OIE World Animal Health Information System. . [Consulta: 28 diciembre 2015]. 66.Wescott D, D King, T Drew, N Nowotny, J Kindermann, D Hannant, S Belak, D Paton. 2003. Use of an internal standard in a closed onetube RT-PCR for the detection of Equine Arteritis Virus RNA with fluorescent probes. Vet. Res. 34: 165 – 176. 67.Wieringa R, A de Vries, J van der Meulen, G Godeke, J Onderwater, H van Tol, H Koerten, A Mommaas, E Snijder, P Rottier. 2004. Structural protein requirements of Equine Arteritis Virus assembly. Journal of Virology. 78 (23): 13019 – 13027. 68.Zhang J, F Miszczak, S. Pronost, C Fortier, U Balasuriya, S Zientara, G Fortier, P Timoney. 2007. Genetic variation and phylogenetic analysis of 22 French isolates of Equine Arteritis Virus. Arch. Virol. 152: 1977 – 1994. 50 69.Zhang J, P Timoney, K Shuck, G Seoul, Y Go, Z Lu, D Powell, B Meade. 2010. Molecular epidemiology and genetic characterization of equine Arteritis virus isolated associated with the 2006 – 2007 multi-state disease occurrence in the USA. Journal of General Virology. 91: 2286 – 2301.