martes, 26 de abril de 2016

DIAGNÓSTICO MOLECULAR DEL VIRUS DISTEMPER CANINO MEDIANTE PCR Cynthia A. Muñoz C. 2013

DIAGNÓSTICO MOLECULAR DEL VIRUS DISTEMPER CANINO
MEDIANTE LA REACCIÓN EN CADENA DE LA POLIMERASA
ASOCIADA A TRANSCRIPCIÓN INVERSA DEL GEN DE LA
PROTEÍNA DE LA NUCLEOCÁPSIDE VIRAL

MOLECULAR DIAGNOSIS OF CANINE DISTEMPER VIRUS BY
REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION
OF THE VIRAL NUCLEOCAPSID PROTEIN GENE

Cynthia Adriana Muñoz Cordero

RESUMEN
El Distemper Canino es una enfermedad viral de distribución mundial, letal y altamente
contagiosa, producida por el Virus Distemper Canino, el cual afecta a un amplio rango de
hospederos, como perros domésticos y representantes silvestres de distintas familias de
carnívoros, comprometiendo drásticamente la conservación de especies amenazadas.
Para el diagnóstico definitivo ante-mortem de la enfermedad, se han sugerido una gran
variedad de parámetros clínicos y diferentes tipos de ensayos, sin embargo, debido al curso
imprevisible y variable de ésta, el diagnóstico final para algunos animales continúa siendo
incierto.
En consideración a lo anterior y a que el desarrollo de técnicas moleculares ofrece diversos
procedimientos para pruebas diagnósticas, el objetivo de esta memoria de título postuló la
detección del gen de la proteína de la nucleocápside del Virus Distemper Canino mediante
la reacción en cadena de la polimerasa asociada a transcripción inversa, como una forma de
diagnóstico rápido y específico para la detección del virus.
La especificidad del método se evidenció por la amplificación del fragmento esperado en el
100% de los controles positivos a Virus Distemper Canino, tanto los tres controles
vacunales (cepa Onderstepoort, Lederle y Snyder Hill), como los diez controles de RNA
viral provenientes desde aislados nacionales, y en la no amplificación del fragmento
esperado en los controles negativos (perros no infectados con y sin vacunación). Sumado a
esto, los fragmentos de DNA amplificados fueron enviados a secuenciar y mediante el
programa BLAST, se confirmó que éstos correspondían a Virus Distemper Canino.
Además, se propone que el método podría tener una alta sensibilidad, debido a la
amplificación del fragmento esperado en el 91% de las muestras de campo provenientes de
perros sospechosos de Distemper Canino.
En base a lo anterior, el método implementado puede colaborar con la prevención y el
control del aumento de Distemper Canino, tanto en la población canina, como en otros
animales susceptibles a la enfermedad.
PALABRAS CLAVE: Virus Distemper Canino, proteína de la nucleocápside, RT-PCR.

ABSTRACT
Canine Distemper is a viral disease of worldwide distribution, lethal and highly contagious,
caused by the Canine Distemper Virus, which affects a wide host range, as domestic dogs
and wild representatives of different families of carnivores, compromising drastically the
conservation of threatened species.
For the definitive diagnosis of the ante-mortem disease, have been suggested a variety of
clinical parameters and different types of assays, however, due to unpredictable and
variable course of this, the final diagnosis for some animals remains uncertain.
In consideration to the foregoing and to the recent development of molecular techniques
provides various methods for diagnostic tests, the objective of this memory postulated the
detection of the nucleocapsid protein gene of Canine Distemper Virus by reverse
transcriptase-polymerase chain reaction, as a form of rapid and specific diagnosis for the
detection of the virus.
The specificity of the method was demonstrated by amplification of the expected fragment
at 100% of the positive controls to Canine Distemper Virus, both three vaccine controls
(strain Onderstepoort, Lederle and Snyder Hill), as ten controls of viral RNA from national
isolated, and in the not amplification of the expected fragment in the negative controls
(uninfected dogs with and without vaccination). In addition to this, the amplified DNA
fragments were sent to sequence and by means the BLAST program, it was confirmed that
these were corresponding to Canine Distemper Virus.
Additionally, it is proposed that the method could have high sensitivity, due to the
amplification of the expected fragment at 91% of the field samples of dogs suspected of
Canine Distemper.
Based on the above, the method implemented can contribute to the prevention and control
of the increase of Canine Distemper, both in the canine population, as in other animals
susceptible to the disease.
KEYWORDS: Canine Distemper Virus, nucleocapsid protein, RT-PCR.
1
INTRODUCCIÓN
Virus Distemper Canino
El Virus Distemper Canino (VDC) pertenece al género Morbillivirus de la familia
Paramixoviridae, orden Mononegavirales y está relacionado antigénicamente con los virus
de la Peste Bovina y del Sarampión. Es un virus pleomórfico con envoltura lipídica, de un
diámetro de 150 a 300 nm, cuyo genoma es un RNA de hebra simple, de sentido negativo y
con una nucleocápside helicoidal. El genoma consta de alrededor de 15,7 kilobases (kb),
que codifica para seis proteínas estructurales: la proteína de la nucleocápside (N), la
fosfoproteína (P), la proteína de matriz (M), la polimerasa (L) y las glicoproteínas de
envoltura, la proteína de fusión (F) y la hemaglutinina (H). Estas últimas dos, ubicadas en
la envoltura lipídica que rodea el virión, son las encargadas del reconocimiento e ingreso
del virus a la célula del hospedador, siendo los objetivos principales de los anticuerpos
neutralizantes que sintetiza el sistema inmune del mismo (Shin et al., 2004, Sidhu et al.,
1993; Summers y Appel, 1994; Von Messling et al., 2001). La nucleocápside helicoidal,
contiene las proteínas N, P y L, las que inician la replicación intracelular. La proteína M,
conecta las glicoproteínas de la superficie y de la nucleocápside durante la maduración viral
(Beineke et al., 2009; Shin et al., 2004).
El gen N, de alrededor de 1,5 kb, es uno de los genes más conservados del genoma VDC y
su región central es la que presenta la menor variación. Posee regiones muy conservadas en
los primeros 2/3 del gen entre los miembros del género Morbillivirus y codifica la más
abundante de las proteínas virales estructurales, la proteína de la nucleocápside, que posee
funciones reguladoras de la transcripción y replicación, así como la encapsidación del
genoma RNA en una nucleocápside RNAsa resistente. No obstante, a pesar de ser una
región muy conservada del genoma VDC, se han demostrado algunas variaciones del gen N
entre aislados de campo (Castilho et al., 2007; Frisk et al., 1999; Gallo et al., 2007;
Keawcharoen et al., 2005).
El VDC, es un virus envuelto muy sensible al medio ambiente, sin embargo su constante
eliminación a través de todo tipo de secreciones y fluidos corporales a partir del séptimo día
postinfección, y su alta infectividad, permiten su rápida diseminación en el ecosistema.
2
Sumado a esto, existen animales infectados que eliminan el virus antes de manifestar signos
asociados a la virosis
(Summers y Appel, 1994).
Hospederos del Virus Distemper Canino
Los hospederos del VDC incluyen numerosas familias del orden de los carnívoros como
canidae (perros, zorros), Procyonidae (mapaches), Mustelidae (hurones y visones),
Mephitidae (zorrillos), Hyaenidae (hienas), Ursidae (osos), Ailuridae (pandas rojos),
Viverridae (ginetas, civetas) y Felidae (tigres, leones, leopardos, jaguares), presentándose
inclusive en mamíferos marinos como pinnípedos y cetáceos.
El Distemper Canino (DC) se ha observado en grandes felinos, en el Parque Nacional del
Serengeti de Tanzania en 1994, en los zoológicos de América del Norte en 1991 y 1992, en
focas del Lago Baikal y Mar Caspio en 1988 y en pecaríes de collar (Tayassu tajacu) en
Arizona. Asimismo la enfermedad DC se ha presentado en primates no humanos, macaco
japonés (Macaca fuscata) infectado naturalmente por primera vez en 1989 en Japón y en el
2006 en China, en monos Rhesus (Macaca mulatta), donde 10.000 animales fueron
infectados (Appel y Summers, 1999; Castilho et al., 2007; Martella et al., 2008; Summers
y Appel, 1994).
Por otro parte, una posible relación entre enfermedad de Paget en los humanos (osteítis
deformante) e infección por VDC ha sido demostrada, debido al descubrimiento de RNA
del virus en tejidos afectados (Frisk et al., 1999; Mee et al., 1998).
En Chile, en el año 1994 se informó del primer aislamiento del virus en cultivos celulares
inoculados con secreciones de un canino con signos clínicos de DC. El diagnóstico clínico
se confirmó por microscopía electrónica y estudios histopatológicos (Cerda et al., 1994).
En el año 2003 ocurrió un brote de DC en las poblaciones de zorros endémicos del Parque
Nacional Fray Jorge (Región de Coquimbo), el cual se especuló que podría estar
relacionado con la existencia de mustélidos nativos como el chingue y el quique (Moreira y
Stutzin, 2005). Además en el 2007, hubo un brote de DC en la isla Robinson Crusoe
(Región de Valparaíso), donde fueron afectados varios perros domésticos, pero no los
lobos marinos endémicos de la isla (Jara et al., 2007).
3
Patogenia del Virus Distemper Canino
La naturaleza de la enfermedad es variable y su curso depende en gran medida de las
interacciones entre el virus y el sistema inmune del hospedero. Si bien todos los perros son
susceptibles al VDC, principalmente son afectados los cachorros de tres a seis meses de
edad, ya que han perdido los anticuerpos maternales y su sistema inmune tiene una menor
eficiencia (Martella et al., 2008, Summers y Appel, 1994).
El virus entra en el hospedero por vía ocular, nasal u oral, y rápidamente se inicia la
replicación en nódulos linfáticos locales y en siete días a todos los tejidos linfáticos
(viremia primaria), produciendo la infección temprana de linfocitos y células
mononucleares, por medio del bloqueo de la síntesis y de las vías de señalización de
interferones y citoquinas, disminuyendo la proliferación de linfocitos B y T, siendo más
afectados estos últimos, lo que resulta en una grave inmunosupresión del hospedero (Von
Messling et al., 2001). Durante la segunda y tercera semana post infección, algunos perros
inician una fuerte respuesta inmune humoral y celular y pueden recuperarse sin signos
clínicos posteriores, mientras otros desarrollan una débil respuesta inmune y presentan la
enfermedad aguda o subaguda, debido a que los linfocitos y células mononucleares
infectadas transportan el virus a la superficie epitelial del tracto digestivo, respiratorio,
urogenital, piel y/o al sistema nervioso central, con los signos clínicos respectivos (viremia
secundaria) (Appel y Summers, 1999).
Signos clínicos de la enfermedad
Los signos pueden ser variables, desde leves a severos, con o sin compromiso del sistema
nervioso central y con alrededor de un 50% de mortalidad (Appel y Summers, 1999).
Días después de la viremia primaria, generalmente aparecen signos como secreción nasal y
ocular, conjuntivitis y anorexia (Martella et al., 2008), y luego de la viremia secundaria, se
pueden presentar signos como secreción nasal, tos, neumonía, diarrea, vómitos, pústulas
dérmicas, entre otros, los que generalmente aparecen aumentados por la infección
bacteriana secundaria. La localización en el sistema nervioso central, dependiendo de la
cepa viral, genera la enfermedad aguda con mioclonía, hiperestesia y depresión, o la
enfermedad subaguda con incoordinación, paresia, parálisis y temblores musculares (Appel
y Summers, 1999).
4
Vacunas
Las vacunas utilizadas en su mayoría corresponden a vacunas polivalentes de virus
atenuados, las cuales confieren una limitada protección a los individuos y además tienen el
riesgo de provocar la enfermedad en los mismos, ya que mantienen su linfotropismo y
capacidad de inducir inmunosupresión, sobretodo en animales inmunodeprimidos o
menores de 6 meses (Keawcharoen et al., 2005; Martella et al., 2008).
Otras alternativas que presentan una mayor seguridad que las anteriores, son las vacunas
recombinantes, que prescinden del patógeno y utilizan algunos de sus antígenos para
estimular adecuadamente al sistema inmune del hospedero. Estas vacunas muestran una
gran eficacia, con una producción de anticuerpos de mayor afinidad y duración que las
vacunas de virus atenuados (Larson y Schultz, 2006).
Considerando que los cachorros no son inmunocompetentes antes de las ocho semanas de
vida y que los anticuerpos maternos duran en el recién nacido aproximadamente entre ocho
y diez semanas, se recomienda vacunar a las seis semanas de edad y para superar la posible
interferencia de los anticuerpos maternos, se debe repetir la vacunación cada 3 semanas
hasta las 12 semanas (2 dosis más), debiendo repetir una vacunación anualmente (Berríos y
Durán, 2005).
Diagnóstico de VDC
De los métodos diagnósticos, la signología clínica es la principal herramienta utilizada por
médicos veterinarios, no obstante, la inespecificidad de los signos en algunos casos
imposibilita llegar a un diagnóstico final, por lo que es necesaria la utilización de pruebas
de laboratorio. Entre ellas, una de las más utilizadas es el ELISA (Enzyme-Linked Immuno
Sorbent Assay), que puede detectar anticuerpos séricos (Acs) IgM (contra las proteínas de
la nucleocápside, N y P del VDC) o IgG (contra los antígenos de la envoltura, H y F del
VDC). Sin embargo esta prueba no diferencia si los Acs producidos corresponden a Acs
maternos, vacunales o por infección. Por lo demás la producción de Acs depende de la
etapa de la enfermedad, pudiendo no encontrarse en fases iniciales y finales de ésta. En
perros no vacunados con infección aguda, éstos pueden morir sin presentar Acs contra el
virus. En animales con signos neurológicos, la determinación de Acs específicos contra
VDC en líquido cefalorraquídeo no contaminado con sangre, es diagnóstico definitivo de
5
encefalitis por DC, sin embargo éste es un método muy invasivo y sus resultados son
variables (Appel y Summers, 1999; Frisk et al., 1999).
Otro método diagnóstico utilizado es la detección de cuerpos de inclusión
intracitoplasmáticos eosinofílicos por citología o por inmunofluorescencia, no obstante,
éstos sólo se pueden visualizar en ciertos periodos de la enfermedad, generalmente estando
ausentes cuando se generan los signos clínicos (Martella et al., 2008; Summers y Appel,
1994). La inmunohistoquímica se utiliza para detectar antígenos virales y/o cuerpos de
inclusión en tejidos, con resultados confiables sólo cuando existe una marcada viremia,
además esta técnica se puede realizar exclusivamente en muestras tomadas post‐mortem
(Frisk et al., 1999; Keawcharoen et al., 2005). El aislamiento del virus, tiene una
sensibilidad y especificidad muy alta, no obstante es un procedimiento laborioso y muy
lento, por lo que no es utilizado rutinariamente para el diagnóstico (Martella et al., 2008).
La reacción en cadena de la polimerasa asociada a transcripción inversa (RT-PCR),
consiste en una amplificación exponencial de fragmentos de DNA del virus, previa
transcripción inversa desde RNA a DNA complementario, permitiendo detectar la
presencia del RNA del virus tempranamente, siendo a diferencia de las otras técnicas
mencionadas, una prueba sensible, específica y rápida para el diagnóstico de VDC, y puede
resultar positiva aún cuando otras pruebas no logran detectar al virus (Appel y Summers,
1999; Frisk et al., 1999; Martella et al., 2008).
En las últimas décadas, se han desarrollado diversos métodos basados en la RT-PCR para el
diagnóstico de VDC, siendo los principales blancos para la amplificación, regiones
genómicas que presentan un alto grado de conservación entre los aislamientos del virus. Es
así, como en 1999 Frisk et al. desarrollaron un método, basado en la amplificación por RTPCR
de un fragmento conservado de 287 pb del gen N del VDC, el cual fue utilizado
posteriormente por diversos autores, demostrando ser un técnica muy eficaz para la
detección del genoma del virus (Calderón et al., 2007; Frisk et al., 1999; Gallo et al.,
2007).
Esta memoria de título tiene como objetivo principal diagnosticar molecularmente el VDC,
a través de la implementación del ensayo de la RT-PCR del gen de la proteína de la
nucleocápside.
6
MATERIAL Y MÉTODOS
El trabajo fue realizado en los laboratorios de Virología y Microbiología del Departamento
de Medicina Preventiva Animal de la Facultad de Ciencias Veterinarias y Pecuarias de la
Universidad de Chile, con financiamiento del PROYECTO FIV 121014019102010.
1.- Controles.
Controles positivos. Una vez establecido el protocolo de la RT-PCR, se probó el
funcionamiento del método con controles positivos provenientes de vacunas y desde
aislados nacionales del virus.
Para los controles positivos vacunales, se utilizó sangre del control negativo sin
vacunación, contaminada con virus vivos atenuados del VDC obtenidos desde las vacunas
“Nobivac® Puppy DP” (cepa Onderstepoort), “Canigen MHA2PPi/L” (cepa Lederle) y
“Vanguard Plus 5/CV-L” (cepa Snyder Hill). Para esto cada vacuna fue reconstituida con
0,5 mL de cloruro de sodio 0.9%, y luego esta mezcla fue agregada a 0,5 ml de sangre, para
posteriormente extraer el RNA.
Los diez controles positivos provenientes de aislados nacionales del virus, correspondieron
a RNA viral que se encontraba guardado en el laboratorio de Virología Animal de FAVET,
a -20 °C por más de un año. Estos aislados provenían de perros domésticos de Santiago de
Chile y fueron confirmados como positivos por una RT-PCR previa basada en el gen de la
hemaglutinina (Jara, 2011; Salas, 2013).
Controles negativos. Se utilizó sangre con anticoagulante de dos animales no infectados,
de un perro adulto sin signos clínicos de la enfermedad, sin antecedentes de riesgo y sin
vacunación y de un perro adulto sin signos clínicos de la enfermedad y sin antecedentes de
riesgo, pero con calendario de vacunación al día (vacunado por última vez hace diez
meses).
2.- Muestras sospechosas de DC
Una vez confirmado el funcionamiento del método con los controles, éste fue probado con
muestras de campo nacionales, donde se analizaron once muestras de sangre periférica con
anticoagulante (2 mL), provenientes de perros que presentaron signos nerviosos
compatibles con DC y que en algunos casos se presentaron positivos a la prueba de ELISA
7
específica para VDC, con títulos de anticuerpos IgM ≥1:80. Estas muestras fueron
recolectadas de clínicas veterinarias de Santiago de Chile, mantenidas en refrigeración a 4
°C y procesadas en un tiempo menor a dos semanas. Además fueron clasificadas según:
raza, sexo, edad, estado de vacunación contra VDC y títulos de anticuerpos IgM anti-VDC
(Cuadro 1).
Canino N° Raza Sexo Edad
Vacunación
contra VDC
Títulos
IgM
1 Poodle Macho 6 años - -
2 Mestizo Hembra 2 años Sí 1:40
3 Mestizo Macho 11 meses No 1:80
4 Bull Terrier Hembra 2 años Sí 1:80
5 Mestizo Hembra 1 año Si 1:80
6 Mestizo Hembra 3 años No 1:40
7 Mestizo Macho 3,5 años No -
8 Bóxer Macho 2 años - 1:40
9 Mestizo Hembra 9 meses No 1:80
10 Mestizo Hembra 1,5 años No 1:20
11 Mestizo Macho 1 año Sí 1:80
Cuadro 1: Clasificación de muestras de sangre periférica provenientes de perros con signos nerviosos
sospechosos de DC, según: raza, sexo, edad, estado de vacunación contra VDC y títulos de anticuerpos
IgM anti-VDC.
3.- Obtención de la capa flogística desde las muestras de sangre sospechosas
En las muestras de sangre con anticoagulante, de los controles negativos y de los animales
sospechosos de DC, se utilizó la preparación “Histopaque®-1077” de Sigma-Aldrich®
según instrucción del fabricante, para el aislamiento de linfocitos y otras células
mononucleares, que son el blanco de la infección por VDC, por lo que se obtuvo una mayor
concentración de RNA viral en las muestras donde se encontraba el virus. Para esto, se
colocaron 2 mL de Histopaque®-1077 en tubos de centrífuga, agregándoles sobre esta
solución, 2 mL de sangre con anticoagulante, para luego centrifugar a 400xg durante 30
minutos a temperatura ambiente. Después se transfirió con cuidado la banda mononuclear
(interfaz opaca) con una pipeta de Pasteur, a un tubo de centrífuga limpio, se lavó con 10
mL de solución salina, se agitó y centrifugó a 250xg durante 10 minutos, para luego aspirar
8
el sobrenadante y desecharlo. Finalmente, las células mononucleares se resuspendieron en
Trizol y se procedió a extraer el RNA.
4.- Extracción de RNA viral mediante kit “Trizol LS” de Invitrogen®
Para la extracción del RNA total de la muestra, se agregaron 750 μL de reactivo Trizol a las
células sanguíneas mononucleares, obtenidas según se describió anteriormente y a 250 μL
de los controles positivos vacunales (sangre contaminada con vacuna), incubando durante
cinco minutos a temperatura ambiente. Luego, a cada tubo se le agregaron 200 μL de
cloroformo, se mezclaron enérgicamente por quince segundos y se incubaron a temperatura
ambiente por cinco minutos. Enseguida, se centrifugaron a 7000xg por quince minutos y se
transfirió la fase acuosa a un tubo limpio. Para la precipitación del RNA, se agregaron 0.5
mL de isopropanol, se dejaron diez minutos a temperatura ambiente, se centrifugaron a
7000xg durante diez minutos, se eliminó el sobrenadante, se lavaron tres veces con etanol
75% (1 mL), se agitaron quince segundos en vortex y sé centrifugaron a 2000xg durante
cinco minutos. Para la resuspensión del RNA se eliminó el sobrenadante, se secó el
precipitado de RNA al vacío durante cinco minutos y se resuspendió en 100 μL de agua
libre de nucleasas. Para finalizar, el RNA fue incubado a 55-60 °C por diez minutos y
mantenido a -20 °C para su uso posterior.
5.- RT-PCR
Se utilizó un termociclador Apollo (CLP, USA) de 96 pocillos de 0,2 mL y un protocolo
con temperaturas, tiempos y ciclos adecuados para cada etapa.
Partidores. Los partidores para el RT-PCR fueron enviados a sintetizar a la empresa
Bioscan®, siendo sus secuencias localizadas en una región muy conservada del gen de la
nucleocápside, y correspondieron a P1: 5’ - ACAGGATTGCTGAGGACCTAT - 3’
(nucleótido 769 - 789) y a P2: 5’ - CAAGATAACCATGTACGGTGC - 3’ (nucleótido
1055 - 1035). Estos partidores permitieron amplificar un fragmento de DNA de alrededor
de 290 pares de bases (pb) (6).
Reacción RT-PCR. Ésta se realizó utilizando el kit “SuperScript™ one step RT-PCR with
platinum Taq” (Invitrogen®) según instrucción del fabricante. La reacción en el
termociclador comenzó con la síntesis de DNA complementario y una predesnaturalización
realizada en un ciclo (45 °C durante treinta minutos y luego dos minutos
9
a 94 °C). Después se llevó a cabo la amplificación por PCR en cuarenta ciclos, la que
consistió en una desnaturalización (94 °C durante un minuto), alineación de los partidores
(60 °C por dos minutos), elongación (72 °C por dos minutos), y una extensión final en un
ciclo (72 °C durante diez minutos) (6).
6.- Detección del fragmento de DNA sintetizado en la RT-PCR
Los productos del RT-PCR fueron analizados por medio de electroforesis en gel agarosa
2% en tampón Tris-HC1 (100 mM Tris-HC1, 10 mM EDTA) y comparación de recorrido
frente a un estándar de tamaño molecular: Hyperladder IV (Bioline®). El producto del PCR
se mezcló con un producto comercial de carga (Fermentas®) y a continuación se realizó la
electroforesis a 90 V por cuarenta y cinco minutos. Después de la electroforesis el gel fue
incubado con bromuro de etidio (0,5 μg/mL) durante treinta minutos, luego fue visualizado
en un transiluminador de luz ultravioleta y posteriormente fue fotografiado.
7.- Secuenciación de fragmentos amplificados
Los fragmentos de DNA obtenidos desde dos muestras positivas se enviaron a secuenciar,
al Centro de Secuenciación de Genytec Ltda.
8.- Análisis bioinformático de las secuencias nucleotídicas de los fragmentos de DNA
Las secuencias obtenidas fueron alineadas utilizando el programa online gratuito ClustalW
2.1 (http://www.ebi.ac.uk/Tools/msa/clustalw2/), obteniendo una secuencia de consenso
para cada muestra utilizada. Además, las secuencias consenso fueron ingresadas al
programa informático de alineamiento de secuencias BLAST 2.2.28
(http://blast.ncbi.nlm.nih.gov/), para identificar el origen de los fragmentos de DNA
obtenidos en la RT-PCR.
9.- Análisis de resultados
Se consideraron positivas aquellas muestras que luego del RT-PCR sintetizaron un
fragmento de DNA de aproximadamente 290 pb y que luego del análisis con el programa
BLAST su identidad nucleotídica correspondió a VDC.

10
RESULTADOS

Implementación del ensayo RT-PCR del gen de la proteína de la nucleocápside del
VDC
Una vez establecido el protocolo de la RT-PCR del gen de la proteína de la nucleocápside
del VDC, se procedió a probar el funcionamiento del método con los controles positivos y
negativos, para posteriormente analizar las muestras de campo sospechosas de DC.
a.- Controles.
Se procesaron tres controles positivos provenientes de vacunas comerciales, diez controles
positivos correspondientes a RNA del VDC (aislados nacionales) y dos controles negativos
procedentes de perros no infectados. Todos estos controles fueron sometidos a la RT-PCR
del gen de la nucleocápside del VDC y luego de la visualización de los productos, todos los
controles positivos generaron bandas intensas de alrededor de 290 pb y en el caso de los
controles negativos, éstos no presentaron bandas visibles (Figura 1).
Figura 1: Visualización productos amplificados por RT-PCR mediante electroforesis en gel de
agarosa al 2% y posterior incubación en bromuro de etidio. Los carriles 1 y 2 corresponden a los
controles negativos, perro no infectado vacunado y sin vacunación respectivamente. Los carriles 3,
4 y 5 corresponden a los controles positivos vacunales, sangre de control negativo sin vacunación
contaminada con vacuna cepa Onderstepoort, Lederle y Snyder Hill respectivamente. Los carriles 6
y 16 corresponden al marcador de tamaño molecular (100 - 1000 pb). Los carriles 7, 8, 9, 11, 12, 13,
14, 15, 17 y 18 corresponden a los controles positivos de RNA viral provenientes de aislados
nacionales a VDC.
11
b.- Muestras sospechosas de DC
Se recolectaron once muestras de sangre periférica de perros con signos nerviosos
concordantes con DC y que en algunos casos se presentaron positivos a la prueba de ELISA
específica para VDC (IgM) (Cuadro 1).
Todas estas muestras fueron sometidas a la RT-PCR del gen de la nucleocápside del VDC y
luego de la visualización de los productos, diez muestras (canino N°1 al N°10, Cuadro 1)
presentaron bandas de alrededor de 290 pb, correspondientes al fragmento de DNA
esperado. Al contrario, la muestra proveniente del canino N°11 no generó bandas visibles
(Figura 2).
Figura 2: Visualización de productos amplificados por RT-PCR mediante electroforesis en gel de
agarosa al 2% y posterior incubación en bromuro de etidio. El carril 1 corresponde al control
positivo vacunal, cepa Onderstepoort. El carril 2 corresponde al control negativo, perro no infectado
sin vacunación. El carril 9 y 16 corresponden al marcador de tamaño molecular (100 - 1000 pb).
Los carriles 3, 4, 5, 6, 7, 8, 11, 12, 13 y 14 corresponden a las muestras de sangre de los perros N°1,
2, 3, 4, 5, 6, 7, 8, 9 y 10 respectivamente. El carril 15 corresponde al perro N°11 (Ver Cuadro 1).
12
c.- Secuenciación de fragmentos amplificados y análisis bioinformático de las
secuencias nucleotídicas de los fragmentos de DNA
Los fragmentos de DNA provenientes de dos muestras consideradas positivas (canino N°1
y canino N°3, Cuadro 1), fueron enviados a secuenciar por triplicado al Centro de
Secuenciación de Genytec Ltda, obteniéndose cinco secuencias para cada muestra
(Anexo_1). El criterio de selección de estas muestras se basó en las edades de los animales,
donde se eligió el canino N°1, de seis años, que es la edad donde se presentaría con mayor
frecuencia una encefalitis crónica debido a la infección por VDC, la cual podría estar
relacionada con mayores variaciones nucleotídicas de acuerdo a Frisk et al. (1999).
Asimismo se eligió el canino N°3, de once meses, que es la edad en la que generalmente se
encuentran más animales infectados por VDC (menores de un año).
Luego las secuencias fueron alineadas utilizando el programa ClustalW, obteniéndose una
secuencia de consenso para cada muestra utilizada: del canino N°1 se obtuvo la secuencia
CDV/CMC1 y del canino N°3 se obtuvo la secuencia CDV/CMC2 (Anexo 2).
A continuación, las secuencias consenso fueron ingresadas al programa BLAST, para
identificar el origen de los fragmentos de DNA obtenidos en la RT-PCR, lo que reveló que
la secuencia CDV/CMC1 presentó un porcentaje de identidad nucleotídica del 95% y la
secuencia CDV/CMC2 del 94%, respecto a los primeros cien resultados correspondientes a
VDC, y que en el caso de ambas secuencias, éstas correspondieron a VDC (Anexo 3).
Además según el análisis de las secuencias, la secuencia CDV/CMC1 y CDV/CMC2
mostraron un porcentaje de identidad nucleotídica de 98/97; 97/95 y 96/95%, respecto a las
cepas vacunales Onderstepoort, Lederle y Snyder Hill respectivamente (Anexo 4).
Por otra parte las secuencias CDV/CMC1 y CDV/CMC2 fueron comparadas mediante el
programa BLAST con otras secuencias del gen N del VDC, representantes de tres linajes
del virus (América 1, América 2 y Asia 1), de acuerdo a la clasificación de Gámiz et al.
(2011). La secuencia CDV/CMC1 presentó un porcentaje de identidad nucleotídica de
alrededor de un 97, 95 y 94% en relación a los linajes América 1, Asia 1 y América 2
respectivamente. La secuencia CDV/CMC2 presentó un porcentaje de identidad
nucleotídica de alrededor de un 96, 94 y 93% en relación a los linajes América 1, Asia 1 y
América 2 respectivamente (Anexo 5).
13
Sumado a lo anterior, las secuencias consenso fueron alineadas con el programa BLAST,
encontrándose un porcentaje de identidad nucleotídica del 95% entre ellas (Anexo 6).

DISCUSIÓN
El DC, es una enfermedad de distribución mundial, viral y altamente contagiosa, que afecta
a una amplia gama de carnívoros terrestres y algunos mamíferos marinos, los cuales han
tenido un aumento progresivo en los últimos años, infectándose incluso animales con sus
planes de vacunación al día. Es debido a este aumento de hospederos, que es trascendental
un diagnóstico certero de la enfermedad causada por el VDC, para limitar la diseminación
del mismo a otros animales y para dar un tratamiento oportuno a los enfermos.
Si bien el diagnóstico de DC se basa principalmente en los signos clínicos del paciente, en
ciertas ocasiones, es difícil llegar a un diagnóstico final por esta vía, ya que los principales
signos respiratorios y digestivos son comunes a otras enfermedades que afectan a los
caninos y en el caso de los signos clínicos más específicos del DC, como signos nerviosos,
éstos ocurren más comúnmente en las etapas posteriores de la infección, después de que
ésta se ha hecho más generalizada. Asimismo, las distintas presentaciones clínicas del DC
varían de un animal a otro, haciendo más complejo el diagnóstico final (Appel y Summers,
1999; Shin et al., 2004).
Si bien existen variadas técnicas para ayudar al diagnóstico del DC, como por ejemplo, el
aislamiento del virus, la inmunofluorescencia y la prueba de ELISA, la mayoría de éstos
métodos son laboriosos, consumen mucho tiempo y pueden dar resultados falsos, por lo
cual no son convenientes para el diagnóstico ante-mortem definitivo de la enfermedad.
Por esta razón, es necesario un método sensible, específico y rápido para descubrir una
pequeña cantidad del virus tempranamente en la infección, lo que gracias al desarrollo de
técnicas biológicas moleculares como la RT-PCR puede ser posible, donde se requiere una
secuencia blanco bien conservada entre diferentes cepas del VDC, para evitar desajustes de
los partidores y la posterior falla al amplificar la misma.
En base a lo anterior, en este trabajo se implementó un método diagnóstico para VDC
mediante la RT-PCR, basado en la detección del gen de la proteína de la nucleocápside, una
región altamente conservada del genoma VDC, lo que hace que este gen sea un buen blanco
14
para la detección molecular de este virus. De hecho, varios autores han revelado la
idoneidad de los métodos de biología molecular basados en el gen de la proteína de la
nucleocápside para la detección del VDC (Frisk et al., 1999; Calderón et al., 2007; Castilho
et al., 2007; Gallo et al., 2007; Gámiz et al., 2011; Shin et al., 2004). Adicionalmente, los
partidores utilizados en este estudio, se encuentran localizados en la región más conservada
del gen de la proteína de la nucleocápside, la zona central, lo cual aumentaría la
sensibilidad del método (Frisk et al., 1999; Gallo et al., 2007)
Aunque en nuestra facultad se han realizado dos memorias de título fundamentadas en la
RT-PCR del VDC (Jara, 2011; Salas, 2013), éstas se basaron en el gen de la hemaglutinina,
el cual posee la mayor variación antigénica y genética entre los genes del VDC,
presentando alrededor de un 10% de variabilidad entre diferentes cepas de VDC, lo cual no
lo hace el gen más adecuado para el diagnóstico del virus (Gallo et al., 2007; Martella et
al., 2008).
En el presente estudio se confirmaron las observaciones anteriores de la utilidad de RTPCR
del gen de la proteína de la nucleocápside del VDC, encontrándose el RNA del virus
en cerca del 91% (10/11) de las muestras de campo sospechosas de DC (Figura 2). Este
resultado sugiere que el protocolo utilizado en esta memoria de título, desde la obtención de
la capa flogistíca hasta la visualización de los productos amplificados, podría ser altamente
sensible. Al mismo tiempo, este método sería más sensible que los protocolos
implementados en los trabajos anteriores, ya que Salas (2013), sólo encontró el RNA viral
en el 7% (3/42) de las muestras analizadas que provenían de perros sospechosos de DC y
en el caso de Jara (2011), éste encontró el RNA del virus en el 83% (5/6) de las muestras
analizadas, que habían sido confirmadas anteriormente como positivas por otra RT-PCR,
sin embargo en veinte muestras de campo de perros sospechosos de DC, no encontró el
RNA viral (Jara, 2011). No obstante, para corroborar la sensibilidad del método
implementado, se requieren estudios adicionales.
La especificidad del método fue corroborada con la amplificación del fragmento esperado
en el 100% (10/10) de los controles positivos y en la no amplificación del fragmento
esperado en los controles negativos (Figura 1).
15
En cuanto a los controles negativos, es importante destacar que uno de los animales usados
para estos controles, presentaba su calendario de vacunación al día y había sido vacunado
por última vez hace diez meses, lo cual apoya las observaciones preliminares de que una
vacunación anterior no causa resultados falsos – positivos (Frisk et al., 1999).
Por otra parte, el VDC puede permanecer activo indefinidamente a -70 °C, -192 ºC
(nitrógeno líquido) o liofilizado y sólo se mantiene activo por alrededor de un mes a -10 °C
(Pérez et al., 1993), sin embargo en los controles positivos correspondientes a RNA del
VDC (proveniente desde aislados nacionales), es importante destacar que este RNA había
sido guardado por más de un año a -20 °C, la cual no es la temperatura ideal para mantener
la integridad y no degradación del mismo, pero a pesar de esto, la estabilidad del RNA del
virus no se vio afectada.
En cuanto al tipo de muestra elegida para las muestras de campo, se escogió sangre con
anticoagulante (ácido etilendiaminotetraacético “EDTA”), debido a que es una de las más
conveniente como substrato para la RT-PCR, ya que es una muestra fácil de obtener,
mantiene la morfología celular por más tiempo impidiendo que el RNA viral sea
degradado por RNAsas endógenas al salir de la célula y además la cantidad de EDTA
presente en los tubos para la obtención de sangre, no inhibiría el resultado de la RT-PCR
(Khosravinia y Ramesha, 2007). No obstante, también se han visto resultados similares con
muestras de suero y orina, aumentando aun más la sensibilidad de la detección si se utiliza
más de una para el diagnóstico de la enfermedad (Frisk et al., 1999; Shin et al., 2004).
Hasta ahora, la confirmación de la infección de VDC en perros vivos no era útil,
principalmente debido al bajo nivel de sensibilidad de los métodos disponibles, como por
ejemplo, la prueba de ELISA, donde el hallazgo de anticuerpos neutralizantes en general
no guarda correlación con los resultados de la RT-PCR (Frisk et al., 1999), tal como se dio
en este estudio, donde algunos animales positivos a la infección por VDC presentaban
títulos de anticuerpos inferiores a los considerados positivos (<1:80 a="" indicar="" lo="" p="" podr="" que="">el papel no contribuyente de los títulos de anticuerpos neutralizantes para el diagnóstico
etiológico de la enfermedad.
La muestra de campo sospechosa de DC que resultó negativa después de ser analizada por
el método propuesto (canino N°11, Cuadro 1), pudo deberse a la ausencia de RNA viral, ya
16
sea porque el virus no se encontraba en sangre, pudiendo estar localizado en otros epitelios
del organismo o porque la muestra fue mal conservada o mal procesada.
Si bien la enfermedad DC es menos frecuente en países desarrollados debido a la
inmunización, en años recientes, el virus que la produce ha surgido como un patógeno
significativo de poblaciones de animales vacunados, y en el caso de este estudio, se
muestra la presencia de algunos animales enfermos de DC, que a lo menos fueron
vacunados una vez contra el virus, lo cual plantea la hipótesis de la falla en la
inmunización de la vacuna, lo que podría estar dado por planes de vacunación incorrectos
o por variaciones genéticas del virus (Castilho et al., 2007), sin embargo para dar respuesta
a estas presunciones es necesaria la realización de otros estudios sobre el tema.
Luego de obtener las secuencias de dos de las muestras que amplificaron un fragmento de
aproximadamente 290 pb y definir la secuencia de consenso para cada una de ellas (Anexo
2), se utilizó el programa BLAST, donde se obtuvo que ambas secuencias presentaron un
porcentaje de identidad nucleotídica mayor al 94% respecto a los primeros cien resultados
correspondientes a VDC y que en ambos casos los fragmentos amplificados pertenecían a
este virus, corroborándose la especificidad de método implementado.
Al alinear las secuencias consenso (CDV/CMC1 y CDV/CMC2) mediante el programa
BLAST, se encontró un porcentaje de identidad nucleotídica del 95% entre ellas, por lo
cual no habrían mayores variaciones entre ambas secuencias (Anexo 6).
Tanto la secuencia CDV/CMC1 como la secuencia CDV/CMC2, mostraron mayor
homología a la cepa Onderstepoort del VDC (98/97% respectivamente) (Anexo 4), similar
a los valores encontrados por Castilho et al. (2007).
A pesar que los fragmentos amplificados se encuentran en una zona altamente conservada
del genoma VDC (gen N), se encontró una variación de las secuencias consenso respecto a
la cepa Onderstepoort de alrededor del 2 – 3%. La posibilidad de que estas substituciones
nucleotídicas pudieran tener un impacto luego de la traducción viral, tiene que ser
justificada por estudios adicionales. Sin embargo en el caso de la secuencia CDV1/CMC1
se presenta una sustitución de un codón respecto a la cepa Onderstepoort (GGG por CCC,
posición 1026 al 1028 de la cepa Onderstepoort, Anexo 4), lo cual podría ocasionar un
cambio aminoacídico pudiendo modificar la estructura de la proteína. Asimismo en 1998,
17
Yoshida et al. encontraron que aislados de VDC en Japón tenían un grupo de
substituciones nucleotídicas que los distinguieron de la cepa de laboratorio Onderstepoort,
pero que estas substituciones de secuencia no tenían correlación con diferencias en la
patología de la enfermedad (Yoshida et al., 1998).
Según el análisis genómico de las secuencias CDV/CMC1 y CDV/CMC2, donde éstas
fueron comparadas con otras secuencias del gen N del VDC (representantes de tres linajes
del virus), ambas secuencias presentaron mayor similitud según el porcentaje de identidad
nucleotídica, al linaje América 1 (Anexo 5).
La técnica implementada, permitiría el aislamiento temprano de los animales infectados y
la instauración de un tratamiento adecuado. Además en el caso de animales silvestres, el
diagnóstico rápido y específico que otorga este método, podría ayudar a la conservación de
especies protegidas, las cuales se han visto en riesgo debido al aumento dramático de
hospederos de VDC acontecido en los últimos años.
CONCLUSIONES
El sistema implementado, representa un método diagnóstico ante-mortem rápido y
específico de la enfermedad Distemper Canino, resultando ser eficaz para la detección del
virus.
La estabilidad del RNA del Virus Distemper Canino, no fue alterada al ser mantenido por
más de un año a -20 °C.
Según el análisis genómico de las secuencias CDV/CMC1 y CDV/CMC2, ambas
mostraron mayor similitud a la cepa Onderstepoort del Virus Distemper Canino y por otro
lado, ambas secuencias mostraron mayor similitud al linaje América 1 del Virus Distemper
Canino.
En base a los resultados de este estudio, el método implementado puede colaborar con la
prevención y el control del aumento de Distemper Canino, ya que éste otorga un
diagnóstico rápido y específico para la identificación del virus responsable, lo cual podría
ayudar a mejorar la salud de la población canina, así como la de otros animales que son
susceptibles a la enfermedad.
18
BIBLIOGRAFÍA

 APPEL, M.; SUMMERS, J. 1999. Distemper canino: estado actual. Institute for
Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, New
York, USA. 5p.
 BEINEKE, A.; PUFF, C.; SEEHUSEN, F.; BAUMGARTNER, W. 2009.
Pathogenesis and immunopathology of systemic and nervous canine Distemper.
Veterinary Immunology and Immunopathology 127: 1-18.
 BERRÍOS, P.; DURÁN, C. 2005. Principales enfermedades virales de los
caninos. Situación en Chile. Monografías Electrónicas de Patología Veterinaria
2: 68-93.
 CALDERÓN, M.; REMORINI, P.; PERIOLO, O.; IGLESIAS, M.; MATTION,
N.; LA TORRE, J. 2007. Detection by RT‐PCR and genetic characterization of
canine Distemper virus from vaccinated and non‐vaccinated dogs in Argentina.
Veterinary Microbiology 125: 341‐349.
 CASTILHO, J.; BRANDÃO, P.; CARNIELI, P.; OLIVEIRA, R.; MACEDO,
C.; PEIXOTO, Z.; CARRIERI, M.; KOTAIT, I. 2007. Molecular analysis of
the N gene of canine Distemper virus in dogs in Brazil. Arquivo Brasileiro de
Medicina Veterinária e Zootecnia 59: 654-659.
 CERDA, L.; MATHIEU, C.; QUINTEROS, G. 1994. Primer aislamiento de Virus
Distemper Canino en Chile. XIV Congreso Panamericano de Ciencias
Veterinarias. Acapulco, México.
 FRISK, A.; KÖNIG, M.; MORITZ, A.; BAUMGÄRTNER, W. 1999. Detection
of canine Distemper virus nucleoprotein RNA by reverse transcription-PCR
using serum, whole blood, and cerebrospinal fluid from dogs with Distemper.
Journal of Clinical Microbiology 37: 3634–3643.
 GALLO, M.; REMORINI, P.; PERIOLO, O.; IGLESIAS, M.; MATTION, N.;
LA TORRE, J. 2007. Detection by RT-PCR and genetic characterization of
canine Distemper virus from vaccinated and non-vaccinated dogs in Argentina.
Veterinary Microbiology 125: 341–349.
 GÁMIZ, C.; MARTELLA, V.; ULLOA, R.: FAJARDO, R.; QUIJANO, I.;
MARTÍNEZ, S. 2011. Identification of a new genotype of canine Distemper
virus circulating in America. Veterinary Research Communications 35: 381–390.
 JARA, C.; MATUS, P.; MOREIRA, R 2007. Distemper Canino en Isla Robinson
Crusoe (Archipiélago Juan Fernández, V Región): antecedentes de un brote
epidémico. Boletín Veterinario Oficial. SAG, Chile 8: 1-19.
 JARA, P. 2011. Detección del gen de la hemoaglutinina del Virus Distemper Canino
mediante la reacción en cadena de la polimerasa asociada a transcripción inversa.
Memoria Título Médico Veterinario. Santiago, Chile. U. Chile, Fac. de Ciencias
Veterinarias y Pecuarias. 18 p.
19
 KEAWCHAROEN, J.; THEAMBOONLERSC, A.; JANTARADSAMEEC, P.;
RUNGSIPIPATB, A.; POOVORAWANC, Y.; ORAVEERAKULA, K. 2005.
Nucleotide sequence analysis of nucleocapsid protein gene of canine Distemper
virus isolates in Thailand. Veterinary Microbiology 105: 137–142.
 KHOSRAVINIA, H; RAMESHA, K. 2007. Influence of EDTA and magnesium on
DNA extraction from blood samples and specificity of polymerase chain
reaction. African Journal of Biotechnology 6 (3): 184-187.
 LARSON, L.; SCHULTZ, R. 2006. Effect of vaccination with recombinant canine
Distemper virus vaccine immediately before exposure under shelter-like
conditions. Vet Ther 7: 113-118.
 MARTELLA, V.; ELIA, G.; BUONAVOGLIA, C. 2008. Canine Distemper virus.
Veterinary Clinics of North America Small Animal Practice 38: 787–797.
 MEE, A.; DIXON, J.; HOYLAND, J.; DAVIES, M.; SELBY, P.; MAWER, E.
1998. Detection of canine Distemper virus in 100% of Paget’s disease samples
by in situ-reverse transcriptase-polymerase chain reaction. Bone 23: 171-175.
 MOREIRA, R.; STUTZIN, M. 2005. Estudio de la mortalidad de zorros en la IV
Región. Boletín Veterinario Oficial. SAG, Chile 3: 1-8.
 PÉREZ, S.; ITURBE, R.; SALDÍVAR, E. 1993. Caracterización del virus del
Distemper (moquillo canino) en cultivos celulares, aislado de animales
clínicamente enfermos. Veterinaria México 24 (1): 15-19.
 SALAS, V. 2013. Análisis filogenético del gen de la hemaglutinina del Virus
Distemper Canino en perros infectados naturalmente en Chile. Memoria Título
Médico Veterinario. Santiago, Chile. U. Chile, Fac. de Ciencias Veterinarias y
Pecuarias. 23 p.
 SHIN, Y.; CHO, K.; CHO, H.; KANG, S.; KIM, H.; KIM, Y.; PARK, H.;
PARK, N. 2004. Comparison of one-step RT-PCR and a nested PCR for the
detection of canine Distemper virus in clinical samples. Australian Veterinary
Journal 82: 83-86.
 SIDHU, M.; HUSAR, W.; COOK, S.; DOWLING, P.; UDEM, S. 1993. Canine
Distemper terminal and intergenic non-protein coding nucleotide sequences:
completion of the entire CDV genome sequence. Virology 193: 66-72.
 SUMMERS, B.; APPEL, M. 1994. Aspects of canine Distemper virus and measles
virus encephalomyelitis. Neuropathology and Applied Neurobiology 20: 525-
534.
 VON MESSLING, V.; ZIMMER, G.; HERRLER, G.; HAAS, L.; CATTANEO,
R. 2001. The hemagglutinin of canine Distemper virus determines tropism and
cytopathogenicity. Journal of Virology 75 (14): 6418–6427.
 YOSHIDA, E.; IWATSUKI, K.; MIYASHITA, N.; GEMMA, T.; KAI, C.;
MIKAMI, T. 1998. Molecular analysis of the nucleocapsid protein of recent
isolates of canine Distemper in Japan. Veterinary Microbiology 59: 237–244.

No hay comentarios:

Publicar un comentario en la entrada