miércoles, 20 de abril de 2016

ARTERITIS VIRAL EQUINA José F. Rivas T. 2016


ARTERITIS VIRAL EQUINA 

José Felipe Rivas Troncoso


PRIMER AISLAMIENTO Y CARACTERIZACIÓN FILOGENETICA DEL VIRUS DE LA ARTERITIS VIRAL EQUINA A PARTIR DE MUESTRAS DE BURROS ASILVESTRADOS (EQUUS AFRICANUS ASINUS) DE LA REGION DE ATACAMA, CHILE

 FIRST ISOLATION AND PHYLOGENETIC CHARACTERIZATION OF EQUINE ARTERITIS VIRUS OF THE SAMPLE EQUUS AFRICANUS ASINUS FROM ATACAMA REGION, CHILE.


 El objetivo de este estudio fue aislar y caracterizar filogenéticamente el virus de la Arteritis Viral Equina (AVE), desde muestras de burros (Equus africanus asinus) serológicamente positivos, provenientes de la Región de Atacama, Chile. Se procesaron muestras de corazón, pulmón, riñón, testículos, conducto deferente, epidídimo, próstata y vesícula seminal pertenecientes a 2 animales, la muestra de conducto deferente fue positiva a la técnica de RT-PCR para los segmentos ORF5, ORF6 y ORF7 las que posteriormente fueron secuenciadas. Además, se realizo aislamiento viral en cultivo celular utilizando la línea celular RK-13, del que se obtuvo un aislado. La cepa Chilena denominada cepa Atacama presentó una similitud nucleotídica 64,9% y aminoacídica 81,4% al compararla con la cepa de referencia Bucyrus. Mediante el análisis de porcentajes de identidad y la confección de árboles filogenéticos, se evidenció que el aislado chileno es una cepa nueva, ya que no hay reportes anteriores de un aislado con estas características genética que además, se encuentra muy alejada filogenéticamente de las cepas de referencia descritas en la literatura. La cepa Atacama se relacionó con aislados de asnales sudafricanos (J1-931125) presentando una similitud nucleotídica de 78,6% y aminoacídica de 93,1%, lo que la clasificaría dentro del subgrupo Europeo-2 según Zhang et al (2007).
 Palabras clave: Aislamiento Viral, Análisis Filogenético, ORF5. 

 II. SUMMARY FIRST ISOLATION AND PHILOGENETIC CHARACTERIZATION OF EQUINE VIRAL ARTERIRITS FROM EQUUS AFRICANUS ASINUSSAMPLESON THE ATACAMA REGION, CHILE The aim of this research was to isolate, and phylogenetically characterize the Equine Viral Arteritis (EVA) virus, taken from samples of serologically positive asses (Equus africanus asinus) from the Atacama Region, Chile. Processed samples include heart, lung, kidney, testicle, vas deferens, epididymus, prostate, and seminal vesicle tissue, taken from two animals. Vas deferens samples were positive for the Reverse transcription - polymerase chain reaction (RT-PCR) technique for segments ORF5, ORF6, and ORF7, which were subsequently sequenced. In addition the study conducted a virus isolation procedure using the RK-13 cell line. The Chilean virus strain also known as Atacama Strain showed a nucleotide similarity of 64.9% and an amino acid similarity of 81.4%, when compared to the Bucyrus reference sample. Through the analysis of identity percentages and the making of phylogenetic trees, the study revealed the fact that the obtained isolation is a new strain, as there is no record of an isolation with such genetic characteristics, which are substantially phylogenetically distinct from the reference strains depicted on the available literature. The Atacama Strain showed to be phylogenetically related with isolations of African origin (J1-931125) presenting a nucleotide similarity of 78.6%, and am amino acid similarity of 93.1%, which classifies it within the European-2 subgroup according to Zhang et al. (2007).
 Keywords: Virus Isolation, Phylogenetic Analysis, ORF5  

III. INTRODUCCIÓN

 La Familia Arteriviridae está compuesta por patógenos que afectan a distintas especies de mamíferos, entre los cuales se encuentran el virus del síndrome reproductivo respiratorio porcino (PRRSV), fiebre hemorrágica del simio (SHFV), arteritis viral equina (AVE) y el virus del aumento de la deshidrogenasa láctica en ratones (LDV) (de Vries et al., 1997, Snijder et al., 2013). Últimamente se ha descubierto un virus que afecta a las zarigüeyas en Australia (Trichosurus vulpecula) síndrome de la zarigüeya floja (wobbly possum disease (WPD)) (Dunowska et al., 2012). Tanto AVE como PRRS cursan con cuadros respiratorios y abortivos, generando grandes pérdidas a nivel productivo (Snijder et al., 2013).

 Etiología
 El virus de la AVE afecta a miembros de la Familia Equidae (caballos, burros, mulas y cebras) (Stadejek et al., 2006), pertenece al Género Arterivirus, Familia Arteriviridae y Orden Nidovirales (Snijder y Meulenberg, 1998, Snijder et al., 2013). Posee un genoma de una hebra de ARN, lineal de sentido positivo (Gorbalenya et al., 2006), tiene un diámetro de 40 a 60 nm (Deshpande et al., 2007). La longitud del genoma es de 12704 a 12731 pares de bases y posee diez marcos abiertos de lectura (ORF) 1a, 1b, 2a, 2b, 3, 4, 5a, 5b, 6 y 7 (de Vries et al., 1992, Firth et al., 2011). ORF 1a y 1b ocupan tres cuartas partes del genoma total del virus y codifican para las proteínas no estructurales: poliproteína 1a, poliproteína 1ab, y nsp1 – nsp12 incluidos nsp1, 2 y 4 que corresponden a proteasas virales (Balasuriya et al., 2013). En tanto, los ORF 2a, 2b, 3, 4, 5, 6, junto con ORF 7 ocupan el cuarto restante del genoma, codificando las proteínas de envoltura (E, GP2, GP3, GP4, proteína ORF5a, GP5 y M respectivamente) y ORF 7 codifica para Nucleocapside (N) (Balasuriya et al., 2013). Las proteínas de envoltura más abundantes son GP5 y M y juntas forman el complejo mayor de envoltura.Las restantes E, GP2, GP3 y GP4 forman el complejo menor de envoltura (de Vries et al., 1992, Wieringa et al., 2004). El principal serotipo identificado es la cepa Bucyrus (Snijder et al., 2013). Las cepas de AVE se dividen en dos grupos, norteamericano (NA) y europeo (EU), éste a su vez se subdivide en dos 4 subgrupos, subgrupo europeo 1 (EU-1) y subgrupo europeo 2 (EU-2) (Balasuriya et al., 1995b, Zhang et al., 2007).

 Epidemiologia

 El virus de la AVE se aisló por primera vez en 1953 en Bucyrus, Ohio, EEUU; en un criadero de caballos Standardbred a partir de equinos con cuadro respiratorio y fetos abortados (Doll et al., 1957). En la actualidad, la enfermedad presenta una distribución mundial y solo se consideran libres Japón e Islandia (Rola et al., 2011). Además, un estudio reciente ha evidenciado la ausencia de arteritis viral equina en la población de caballos de Nueva Zelanda (McFadden et al., 2013). El aumento en el movimiento de equinos a nivel mundial, la inseminación artificial, la carencia de medidas de bioseguridad y fallas en el cumplimiento de las medidas de control, ha incrementado la diseminación del virus (Rola et al., 2011). Estudios serológicos en equinos han demostrado una prevalencia en Europa superior al 20% a excepción de Gran Bretaña que no sobrepasa el 2% (Glaser et al., 1997; Rola et al., 2011), Polonia 17,4% (Larska y Rola, 2008), Suiza 11,3%, (Holyoaket al., 2008), Estados Unidos 1,9% en caballos propios y en caballos importados, un 19,4% en hembras y un 16,1% en machos (Hullinger et al., 2001). En Estados Unidos, se observa una variación dependiendo de la raza, es así como, los caballos Standardbred presentan prevalencias de 77,5 a 84,3% y los caballos Thoroughbred van desde 0 a 5,4% (Holyoak et al., 2008) La transmisión del virus puede ser de forma horizontal como vertical. El contagio horizontal puede ser por vía respiratoria por contacto con aerosoles o secreciones respiratorias de otros equinos con infección aguda, orina, membranas fetales de abortos (Timoney y McCollum, 1987, Balasuriya, 2014) o infección ambiental con semen de potros con infección crónica (Guthrie et al., 2003). La hembra también se puede contagiar vía venera por monta natural desde el macho portador crónico, por inseminación artificial o transferencia de embriones (Timoney y McCollum 1988, Balasuriya, 2014). El contagio vertical se produce cuando una hembra preñada se infecta con AVE, si ésta llega al término de la gestación el potrillo nace 5 infectado, muriendo a los pocos meses de vida (Glaser et al., 1996, Timoney y McCollum, 1996). En machos, después de la infección aguda, el virus se aloja en el ámpula y las glándulas sexuales accesorias generando un estado de portador o infectado crónico entre 10 y 70% de los machos infectados, el cual es testosterona dependiente (Balasuriya, 2014), éste estado se da solo en machos enteros (no castrados), mayores a 6 meses y es la principal forma de mantención del virus en la naturaleza (Timoney y McCollum, 1988). Signos Clínicos El periodo de incubación del virus es de 2 a 14 días, en la exposición venérea es de 6 a 8 días promedio, seguido por un periodo de fiebre de 2 a 9 días (Balasuriya et al., 2013). Al ingresar el virus por vía respiratoria alta, replica en las células del epitelio e infecta a nivel pulmonar los macrófagos alveolares dentro de las primeras 24hrs post-infección (PI). Luego, migra a los linfonódulos regionales, principalmente bronquiales a las 48hrs PI, presentándose la viremia dentro de los 3 días PI (McLachland et al., 1996). En machos enteros, se genera el estado de portador del virus en el periodo virémico. 10 días PI se genera severo daño al endotelio vascular, y aborto en hembras gestantes. 10 a 21 días PI el virus migra al epitelio de los túbulos renales y el virus es diseminado por la orina (Del Piero, 2000). La presentación de los signos clínicos depende de varios factores incluidos genéticos, edad, condición corporal, dosis infectante, ruta de infección, cepa viral y factores ambientales (Balasuriya, 2014). El signo más común es la fiebre, en el hemograma se observa una marcada leucopenia, pero en los casos de animales jóvenes, muy viejos, débiles o inmunodeprimidos pueden presentar además decaimiento, anorexia, rinitis mucopurulenta, edema en declive (escroto, prepucio, glándula mamaria, ventral al tronco y miembros), problemas en la marcha (rigidez al caminar), lagrimeo, conjuntivitis, edema periorbital y supraorbital, diestress respiratorio, urticaria desde la cara y cuello hacia el resto del cuerpo (Glaser et al., 1996; Del Piero. 2000; Balasuriya, 2014). Dependiendo de la cepa viral, en hembras de 3 a 10 meses de gestación genera aborto entre 10 a 70% 6 aproximadamente (Vaala et al., 1992). Este se atribuye al daño en el miometrio producido por la replicación viral lo que disminuye la irrigación fetal, generando estrés y desencadenando el aborto (McLachland et al., 1996). En los fetos abortados, se observan pulmones con edema interlobulillar, efusión pericardica y pleural, petequias y equimosis tanto en mucosa como en serosa del intestino delgado. Histológicamente se evidencia una panvasculitis necrotizante en pequeños vasos, estas lesiones se pueden observar en la placenta, cerebro, hígado y bazo del feto (Balasuriya, 2014).

 En la naturaleza, se observa mortalidad solo en neonatos, éstos presentan cuadros de neumonía intersticial fulminante, los potrillos que sobreviven desarrollan, un síndrome neumo-entérico, entre 1 y 3 meses de edad (Vaala et al., 1992). Mortalidad en adultos solo se ha observado en infecciones experimentales (McLachland et al., 1996). Se describe una resistencia genética al virus asociado a linfocito T CD3+, los animales resistentes presentan mayor signología clínica, asociada a una mayor respuesta inmune (Go et al., 2012). Diagnostico En caso de sospecha de AVE debido a la sintomatología, es necesario realizar un diagnostico confirmatorio para determinar el agente etiológico, ya que dependiendo del lugar geográfico, hay distintos agentes que presentan similar sintomatología, es así el caso de Herpesvirus Equino tipo 1 y 4, Influenza Equina, Anemia Infecciosa Equina, Adenovirus Equino y Leptospira (Balasuriya, 2014). La identificación del agente se puede realizar por medio de aislamiento viral para el cual se recogen muestras de sangre no coagulada, muestras nasofaríngeas (Westcott et al., 2003), conjuntivales, y semen de los posibles portadores. En brotes de aborto y potrillos mortinatos se toman muestras de líquidos fetales y placentarios y tejido, idealmente pulmón (OIE, 2013). Esta es una prueba aprobada por la Organización Internacional de Epizootias (OIE, 2013) en esta prueba se inocula el virus desde las muestras antes mencionadas en cultivos celulares de monocapa la cual puede ser de riñón de conejo (RK-13 (Asagoe et al., 1997)) o riñón de hámster bebe (BHK-21) (Wagner et al., 2003). Los cultivos 7 se revisan todos los días, de estos, los positivos deberán presentar efecto citopático dentro de 2 a 6 días. El cual se verificara con pruebas como anticuerpos mono y policlonales, inmunohistoquímica y RT-PCR estándar o a tiempo real (OIE, 2013; Balasuriya, 2014) Los métodos serológicos más utilizados para determinar la presencia de AVE se encuentran la seroneutralización viral (SNV) (OIE, 2013), ensayo por inmunoabsorción ligado a enzima (ELISA) (Mertz et al., 2014). La SNV es uno de los métodos más utilizadas debido a su sensibilidad y eficiencia, ha sido implementada por la Organización Internacional de Epizootias (OIE), como prueba de referencia para diagnostico de la enfermedad. Se utilizan muestras de sangre estéril, uso de células monocapa RK-13 y como virus, cepa CVL-Bucyrus o cepa vacinal MLV atenuada. Los sueros positivos se determinan microscópicamente por efecto citopático entre 48 y 72hrs post inoculación, el cual se considera positivo si no hay reducción del cultivo celular en comparación a los pocillos control (OIE, 2013). El uso de ELISA es otra prueba serológica ampliamente difundida para detectar anticuerpos contra AVE. Estos son de carácter directo (Wagner et al., 2003) o indirecto (Chung et al., 2013) los que van dirigidos a la proteína GP5, la cual estimula la respuesta inmune humoral (Chung et al., 2013). Esta prueba presenta símil especificidad y sensibilidad que seroneutralización, pero a diferencia de esta se pueden obtener reacciones positivas antes. Se han descrito ELISAS con una especificidad 99,5% de especificidad y 98,2% (Chung et al., 2013) en comparación a seroneutralización viral. El uso de métodos moleculares, RT-PCR convencional (Liu et al., 2008), RT-PCR tiempo real (Balasuriya et al., 2002a, Miszczak et al., 2011), RT-PCR anidado (Westcott et al., 2003), se utilizan como métodos para complementar el aislamiento vírico en cultivo celular y para la identificación ARN específicos de muestras de semen, filtrados de hisopos nasofaríngeos, capas leucocitarias y muestras de tejido post-mortem (OIE 2013, Balasuriya et al., 2013). Estas pruebas van principalmente dirigidas a los ORF: 1b, 3, 4, 5, 6 y 7 (Balasuriya et al., 2013; 8 Liu et al., 2008; Rola et al., 2013). En donde ORF 5 es el segmento más confiable para determinar el grupo viral para lo cual se utiliza RT-PCR convencional (Stadejek et al., 1999; Zhang et al., 2007). Secuenciación y Análisis Filogenético El análisis filogenético se puede realizar desde ORF1b a ORF7. Se han realizado arboles de ORF6 (Echeverría et al., 2007) y ORF 7 (Larska y Rola 2008), pero éstos no son tan confiables como ORF5. Este gen codifica para la glicoproteína (GP5), la cual forma parte del complejo mayor de envoltura, siendo la proteína de mayor variabilidad antigénica (Stadejek et al., 1999; Hornyak et al., 2005; Mittelholzer et al., 2006; Zhang et al., 2007, Surma-Kurusiewicz et al., 2013). ORF5 con un tamaño de 768 pares de bases (pb) (Balasuriya et al., 2013), se divide en tres segmentos variables (V1, V2, V3) y cuatro segmentos conservados (C1, C2, C3, C4). Tiene 4 sitios mayores de neutralización en el ectodominio (A,B,C,D), los que junto con la proteína M generan los epítopos neutralizantes (Balasuriya et al., 2004a). B, C y D se encuentran dentro del segmento V1 (Balasuriya et al., 1995a, Balasuriya et al., 1997, Rola et al., 2013). Este segmento es el menos conservado dentro de ORF5 y es el que genera nuevas variantes del virus AVE (Hornyaket al., 2005, Surma-Kurusiewicz et al., 2013). La variación de estos ectodominios se debe a que el virus está en constante presión por el sistema inmune lo que genera por medio de la pérdida y adición de sitios de glicosilación, la variación de la proteína viral (Zhang et al., 2007) Este proceso se lleva a cabo durante el estado portador en machos (Balasuriyaet al., 2004a). De AVE solo existe un solo serotipo Bucyrus (GenBank Nº NC_002532) (Snijder et al., 2013), el cual se divide en dos grupos, uno Norteamericano (NA) y otro Europeo (EU), este ultimo a su vez se divide en 2 subgrupos EU-1 y EU-2 (Zhang, 2007) Dentro del grupo norteamericano también clasificado como IA y IB según Stadejek et al (1999) o EAV-2, por Mittelholzer et al (2006), se encuentran cepas aisladas en Nueva Zelanda, Canadá, Estados Unidos, Gran Bretaña, Dinamarca, Hungría (Hornyak et al., 2005), Noruega, Países Bajos, cepa vaccinal ARVAC 9 (Zhang, 2007). En tanto en el subgrupo EU-1 (IIA por Stadejek et al (1999) o EAV- 1 por Mittelholzer et al (2006)) se encuentran cepas de Francia, Hungría, Qatar, Gran Bretaña, Austria, Alemania, Polonia (Rola et al., 2013), Italia, Bélgica y Sudáfrica (Zhang, 2007). En tanto en el subgrupo EU-2 (IIB por Stadejek et al (1999), EAV-3 por Mittelholzer (2006)) se encuentran aislados de Hungría, Austria (Hornyak et al., 2005), Suecia, Noruega, Gran Bretaña, Italia, Hungría, Dinamarca, Sudáfrica (aislado desde burros) (Mittelholzer et al., 2006; Zhang et al., 2007). Y Argentina (Metz et al., 2008). Dentro del grupo Norteamericano se han encontrado cepas de origen europeo (NL1, GB2) así como también se han encontrado en el grupo europeo cepas de origen norteamericano (USA8, USA18), lo cual se relaciona con movimiento de animales entre continentes (Stadejek et al., 1999; Mittelholzer et al., 2006). En el grupo EU-1 se han aislado 2 cepas europeas de burros en Italia (Stadejek et al., 1999) en tanto se han aislado 9 cepas de origen sudafricano de baja patogenicidad y virulencia, las cuales se correlacionan entre sí con muy poca variabilidad, están incluidas dentro del grupo EU-2, sin embargo estas se encuentran muy alejadas filogenéticamente de las otras cepas del grupo, tampoco se encuentra en cercanía a las cepas de caballos lipizzanos sudafricanos que pertenecen al grupo EU-1, lo que sugiere que esta cepa es una variante única de AVE, la cual ha estado presente desde mucho tiempo atrás y es propia de la población de asnales (Zhang et al., 2007; Stadejek et al., 2006).

 Situación enChile

 Según el Decreto Exento Nº 389 (2014) AVE es una enfermedad de denuncia obligatoria al Servicio Agricola Ganadero (SAG).Hasta el año 2013, el virus de la arteritis viral equina no había sido descrito en Chile, como se observa en los registros de la lista de enfermedades de denuncia obligatoria de la OIE (WAHIS, 2015a). A partir de esta fecha, el SAG confirma el diagnóstico en un laboratorio de referencia internacional (SAG, 2014), por ello se notifica la presencia de la enfermedad a la OIE y Chile se reporta con un estado de infección o infestación 10 limitada a una o más zonas, adoptando medidas de control para su vigilancia general y dirigida (WAHIS, 2015b). Para el control de esta enfermedad se publica la resolución exenta Nº 4138 (2014), donde se establece la zona de control sanitario de AVE en población de asnales de las Comunas de Huasco, Freirina, Vallenar y la Higuera, para ello se procede a marcar machos enteros castrados y se prohíbe la salida de este perímetro a menos que sea castrado. La Comuna de Freirina, de Provincia de Huasco, en la Región de Atacama, es la Comuna a nivel nacional que presenta la mayor proporción de animales por productor del País, reportándose 51 existencias en promedio por cada uno de éstos (INE, 2007). En Chile, según el censo agropecuario 2007, hay una existencia de 15016 asnales en el país, la Región de Atacama y Coquimbo concentran el 80% de esta población: Coquimbo con 8784 existencias lo que corresponde al 58,4% y Atacama con 3357 existencias correspondientes al 22,3% de población de asnales del país (INE, 2007). Según el SAG a partir de un estudio serológico realizado por Moreira et al., (2014), habría una prevalencia de AVE de un 53% (312 muestras). El año 2014 el SAG reporta el último brote en burros asilvestrados (Equus africanus asinus) de la Región de Atacama (SAG, 2015). Aparte del estudio serológico realizado en Chile, no hay evidencia concreta de la presencia del virus, ya que aún no se ha aislado. Por este hecho, sería relevante aislar el virus para confirmar la infección y una vez aislado, efectuar un estudio filogenético, con él se podría determinar el tipo de cepa presente, la probable procedencia de ésta, si esta provendría desde caballos o desde asnales y si existe relación con cepas descritas en la literatura, según el grado de similitud que tenga con estas, o si se trataría de una cepa nueva. De esta forma es posible implementar medidas más eficaces de diagnostico, así de esta forma controlar la enfermedad. 11 Hipótesis HA0: Existe infección de arteritis viral equina en Equus africanus asinus con una cepa viral la cual no tiene relación genética con las cepas de caballos, en la región de Atacama, Chile HA1: Existe infección de arteritis viral equina en Equus africanus asinus con una cepa viral la cual tiene relación genética con las cepas de caballos, en la región de Atacama, Chile

 Objetivos

 Objetivo General ● Aislar y caracterizar filogenéticamente el virus de la arteritis viral equina desde muestras de Equus africanus asinus de la región de Atacama, Chile Objetivos Específicos ● Aislar el virus de arteritis viral equina mediante cultivo celular a partir de muestras de tejido de Equus africanus asinus serológicamente positivos. ● Diagnosticar infección de arteritis viral equina a partir de aislados celulares positivos mediante método RT-PCR para ORF 5, 6 y 7. ● Caracterizar filogenéticamente a través de secuenciación genética, los ORF 5,6,7 de AVE para determinar la existencia de una o más cepas ● Determinar la relación filogénica del virus de burro y las cepas de referencia. 

 IV. MATERIALES Y METODO

 Muestras Se analizaron, muestras de tejido a partir de necropsias, de 2 burros machos enteros serológicamente positivos provenientes de la Región de Atacama de la Comuna de Freirina, en la Provincia de Huasco. Éstos fueron adquiridos por la Unidad de Virología, Subdepartamento del Laboratorio y Estación Cuarentenaria Pecuaria, Lo Aguirre del SAG. A partir de estos individuos se analizaron muestras de tejidos provenientes de corazón, pulmón, riñón, testículos, conducto deferente, epidídimo, próstata y vesícula seminal. Estas muestras llegaron a la Unidad de Recepción de Muestras, del complejo. Las muestras, fueron enviadas a la subunidad de Virología donde se almacenaron a -40ºC, a estas posteriormente se les extrajo el material genético. Extracción de ARN Para determinar la presencia del virus en los tejidos, se utilizo el ensayo RT-PCR, para desarrollar esta prueba, primero fue necesario realizar extracción de ARN, para lo cual se utilizo un kit comercial (Ambion® AM 1835) en donde, la extracción se realizo siguiendo las especificaciones del fabricante. Una vez, obtenido el material genético, este fue enviado a la Unidad de Biotecnología del establecimiento. Donde se realizo el análisis RT-PCR. RT-PCR Diagnostico Para realizar ésta técnica, se utilizo un kit comercial (Qiagen® ONE STEP), siguiendo el protocolo recomendado por el fabricante. Posteriormente se procedió a la amplificación del segmento ORF6 y ORF7 siguiendo las recomendaciones según el manual de la OIE (2013), mediante el uso de un termociclador (Applied Biosystems® 2720 Thermal Cycler). Los productos de RT-PCR fueron pasados a un gel de agarosa al 1.5% teñido con bromuro de etidio, utilizando una fuente de poder (PolyScience®model 500-2) a 90 voltios por 45 minutos. Los productos de RT-PCR fueron reportados como positivos o negativos al ser visualizado por untransiluminador UV, considerándose positivo las bandas de 193 pares de bases (pb) para el RT-PCR contra ORF6 y 316pb para el RT-PCR contra ORF7 en las reacciones amplificadas. Las muestras que resultaron positivas, fueron seleccionadas para realizar la inoculación en cultivo celular. Aislamiento Viral en Cultivo Celular A partir de los tejidos positivos a la técnica RT-PCR, se realizo el cultivo celular. Este, se llevo a cabo en la sala de incubación de la Unidad de Virología, en donde, se utilizaron células RK-13 suministradas por la Unidad de Cultivo celular. Las células, llegaron a la Unidad de Virología en placas de cultivo celular de 12 pocillos, más un frasco con 10 mL de medio esencial mínimo Eagle´s (MEM), suplementado con 10% de suero fetal bovino, 10.000 UI/mL de penicilina (1%), 10.000 µg/mL de estreptomicina (1%), y 25 µg/mL de amfotericina B (1%). Las células, listas para ser inoculadas presentaron una confluencia de aproximadamente un 80%. Antes de comenzar éste procedimiento, la placa fue rotulada con las muestras que se utilizaron en cada pocillo, número de pasajes y fecha de inoculación. A partir de los tejidos positivos, se extrajo 1gr de raspado desde la superficie del órgano, la cual fue homogeneizada en un mortero junto con MEM. El resultado, se extrajo en tubos Falcon® 45ml para posteriormente ser centrifugados a 5000rpm durante 20 minutos, el sobrenadante es pasado por filtros de membrana para jeringa de 0.45µm (gyro Disc® Orange Scientific). Este filtrado se inoculo en células RK-13, las que se fueron cultivadas como mínimo 1 hora a 37º C y con una saturación de CO2 5% y un 95% humedad. El inóculo se realizo en duplicado con distintas volúmenes de 50µL, 100µL y 200 µL del filtrado. Una vez terminada la incubación, se retiro el sobrenadante y fue restituido por 800 µL de MEM, posterior a esto las células fueron incubadas en las mismas condiciones antes mencionadas por un periodo de 5 a 7 días, las cuales fueron observadas todos los días para determinar efecto citopático. Las muestras que se consideraron positivas fueron 14 aquellas que presenten un 75% de reducción en comparación con las células control. RT-PCR Contra ORF5 Este procedimiento se realizo con muestras positivas a cultivo celular y muestras de tejido positivas a la técnica de RT-PCR, en caso de los virus que no pudieron replicarse en cultivo celular. Se utilizo el método de extracción de ARN antes mencionado. Además de amplificar los segmentos ORF6 y ORF7 se incluyo el segmento ORF5. Para la realización de la RT-PCR convencional contra el segmento ORF5 los partidores a utilizar amplificaron 808pb de la región ORF5 de AVE. 11253: 5’- GACGGATCGCGGCGTTATTG – 3’ Posición: 11253 - 11272 (Stadejek et al., 1999) RORF6: 5’- GCAGCCAAAAGCACAAAAGC – 3’ Posición: 12105 – 12124 (OIE, 2013) Para el desarrollo de la técnica se utilizo el kit comercial QIAGEN OneStep RTPCR, formando una mezcla maestra, la cual contiene: 5 μL de 5x buffer PCR, 0,8 μL de dNTPs (10Mm), 0,6 μL de MgCl2 (50Mm), 0,3 μL de Inhibidor de Rnasa (40 U/μL), 0,8 μL de cada partidor (20pmol/μL), 1 μL de Enzima MixQuiagen, 7,7 μL de RNAase free wáter, 8 μL de templado ARN, completando un volumen total de 25 μL. . Posteriormente se procedió a amplificar el segmento ORF5 del AVE mediante el uso de un termociclador (Applied Biosystems® 2720 ThermalCycler). Para amplificar el material genético se realizo primero un proceso de transcripción reversa a 50°C durante 30 minutos. A continuación, una desnaturalización inicial a 95°C por 15 minutos, posteriormente 35 ciclos que constan de una fase de desnaturalización a 94°C por 45 segundos, una fase de apareamiento a 60°C por 60 segundos y una fase de elongación a 72°C por 90 segundos. Por último, la 15 muestra fue sometida a una fase de elongación final a 72°C por 10 minutos, obteniéndose un producto de 808pb. 

Purificación de ADN Los productos que midieron 808pb en el RT-PCR contra ORF5, 193pb en el RTPCR contra ORF6 y 316pb en el RT-PCR contra ORF7 fueron extraídos desde el gel de agarosa los que posteriormente fueron purificados mediante el uso de un kit comercial (QIAquick® Gel Extraction Kit) siguiendo el protocolo recomendado por el fabricante. Finalmente, se medio la cantidad de ADN (ng/μL) y pureza (razón A260/280) del ADN purificado en un espectrofotómetro (Nanodrop® ND-1000 Spectophotometer). Análisis filogenético de las secuencias en estudio Los productos purificados, fueron enviados para el proceso de secuenciación a la empresa Macrogen Inc. Fue enviado el ADN purificado junto a 1 par de partidores, correspondientes a cada segmento amplificado: ORF5, ORF6 y ORF7. El análisis filogenético molecular de las secuencias nucleotídicas obtenidas por RT-PCR, se realizo usando el programa MEGA de análisis bioinformático. Para ello, las secuencias nucleotídicas obtenidas se alinearon para cada una de las regiones por separado mediante el programa ClustalW® 2.0 (Larkin et al., 2007). Una vez, realizado el alineamiento múltiple, se procedió a la construcción de árboles filogenéticos, incluyendo cada secuencia analizada mediante el programa MEGA® 6.0 (Mishra et al., 2007). Se utilizo para esto el método de “NeighborJoining” (Saitou y Nei, 1987), tomando como modelo de sustitución de bases el método de dos parámetros de Kimura (1980) y para probar la fuerza del análisis y la significancia del ordenamiento se realizo un “bootstrap” de 1000 réplicas. 16 Protocolo de Bioseguridad y procedimientos a seguir durante la ejecución del estudio. Todos estos procedimientos, fueron ejecutados bajo las normas de bioseguridad que tendieron a contener e impedir la diseminación al medio ambiente de agentes patógenos que se manipulen dentro de la Unidad de Virología. Con respecto, a las personas que visiten la Unidad, deben hacer lectura del instructivo e identificarse antes de ingresar al laboratorio. Toda persona que ingrese al laboratorio hará cambio total de ropa y para su salida deberá realizar una ducha de descontaminación. Con respecto al personal, la manipulación de las muestras en el estudio experimental fue realizada por personal técnico debidamente capacitado en el manejo de muestras biológicas, el cual se protegió con delantales, guantes, gorros y anteojos de plástico. Para realizar la desinfección y contención se utilizo Virkon®, alcohol 70° y alcohol yodado. En cuanto al equipamiento utilizado, el laboratorio cuenta con presión negativa en todas sus salas y de cámaras de flujo laminar. Además, la unidad cuenta con autoclaves en donde se esterilizan todos los materiales que son posteriormente sacados y llevados a la sala de lavado. 

 V. RESULTADOS

 A partir de las muestras procesadas del protocolo 7634 y 7635, los tejidos correspondientes a conducto deferente, próstata y vesícula seminal del protocolo 7634, fueron positivos para la técnica RT-PCR para los segmentos ORF6 y ORF7. En tanto, la muestra de conducto deferente correspondiente al protocolo 7634, fue positiva a la técnica RT-PCR para el segmento ORF5 (figura 1). Figura 1. Gel de agarosa al 1,5%. Carril 1 y 2: muestras positivas a AVE, ORF5; Carril 3 y 4: Control negativo; Carril 5: Control positivo a AVE, ORF5; carril 6 Ladder. Estas muestras lograron ser secuenciadas y posteriormente editadas, obteniendo una secuencia parcial para el segmento ORF5 de 630 pares de bases (pb); ORF6 de 193pb y ORF7 de 316pb. Estos segmentos, fueron analizados por el programa BLAST (NCBI), el cual indicó que pertenecían a AVE con una identidad del 77% para la secuencia de ORF5; 85% para ORF6; 91% para ORF7, los que para este estudio será identificada como cepa Atacama. Posteriormente, se procedió a compararlos con cepas descritas en la literatura, para los segmentos ORF7 y ORF6 se utilizaron las cepas de referencia observadas en la Tabla 1. 18 Tabla 1. Cepas de referencia para AVE utilizadas para comparar el segmento ORF6 y ORF7 Cepa Origen Nº GenBank Grupo Bucyrus USA DQ846750 NA VBS53 USA U81013 NA ARVAC USA U81019 NA ATCC USA U81020 NA CDN2 (CAN8) Canadá U81021 NA CW01 USA AY349168 EU-2 CW96 USA AY349167 EU-2 F15 Francia EF492553 EU-2 F10 Francia EF492548 EU-2 F9 Francia EF492547 EU-1 F5 Francia EF492543 NA G1 Gran Bretaña AF118777 EU-1 P1 Polonia AF118775 EU-1 Donde se indica nombre de la cepa, origen, número correlativo en base de datos GenBank y grupo al que pertenecen: Norteamericana (NA), Europeo-1 (EU-1) y Europeo- 2 (EU-2). Bucyrus, VBS53, ATCC, CDN2 (Patton et al., 1999); CW96, CW01 (Balasuriya et al., 2004b); ARVAC, F15, F10, F9, F5 (Zhang et al., 2007); G1, P1 (Balasuriya et al., 1999). Para el segmento parcial de ORF7, se evidenció una similitud nucleotídica con un rango que varía entre 86,0% (cepas Bucyrus, VBS53, ATCC, CDN2) y 87,2% (cepa F10). En tanto, la similitud aminoacídica varió desde 92,7% (cepa ARVAC) a 95,9% (cepas CW01, CW96, F9, G1 y P1). Para el caso de la cepa de referencia Bucyrus, se evidencia un 86,0% de similitud nucleotídica y un 93,8% de similitud aminoacídica (Figura 2). 19 Figura 2. Porcentaje de similitud de nucleotídica y aminoacídica del segmento parcial de ORF7 de la cepa Atacama con las distintas cepas de referencia de AVE. *comparación nucleotídica; **comparación aminoacídica. 

 En el árbol filogenético del segmento ORF7 de AVE, se evidencian 3 grupos filogenéticos: Norteamericano, formado por las cepas VBS53, ATCC, Bucyrus, ARVAC, F5, CDN2 (CAN86); subgrupo Europeo-1, formado por las cepas F9, G1 y P1; subgrupo Europeo-2, formado por las cepas CW01, CW96, F15 y F10; y la cepa Atacama, la cual se encuentra más alejada del resto de las cepas de referencia de AVE (Figura 3). Figura 3. Árbol filogenético del segmento parcial ORF7 de AVE. Cepas del grupo Norteamericano (rojo), cepas del subgrupo Europeo-1 (azul), cepas del subgrupo Europeo-2 (amarillo), cepa Atacama (verde). Al comparar el segmento parcial de ORF6, se observó que hay una similitud nucleotídica de entre 71,9% y 79,8%, siendo la cepa ARVAC la que se encuentra más distante nucleotídicamente de la cepa Atacama y la cepa F9 la más cercana, en tanto la cepa de referencia Bucyrus presenta un 73,1% de similitud nucleotídica. La similitud aminoacídica varía de un 84,8% (cepas ARVAC, ATCC y CDN2) a un 88,4% (cepas Bucyrus, VBS53, ATCC, F15, F10, F9, F5, G1 y P1) (Figura 4). 21 Figura 4. Porcentaje de similitud de nucleotídica y aminoacídica del segmento parcial de ORF6 de la cepa Atacama con las distintas cepas de referencia de AVE. *comparación nucleotídica; ** comparación aminoacídica. 22 En el árbol filogenético de ORF6 de AVE, se observan 3 grupos: Norteamericano, en el que se encuentran la cepa de referencia Bucyrus, junto a las cepas ARVAC, CND2, ATCC, VBS53 y F5. El subgrupo Europeo-1, con cepas P1, F9 y G1; subgrupo Europeo-2, con cepas F10, F15, CW01, CW96 y la cepa Atacama, esta se encuentra más alejada filogenéticamente del resto de las cepas de referencia de AVE(Figura 5). Figura 5. Árbol filogenético del segmento parcial ORF6 de AVE. Cepas Norteamericanas (rojo), cepas del subgrupo Europeo-2 (amarillo), cepas del subgrupo Europeo-1 (azul), cepa Atacama (verde). Para el segmento parcial de ORF5, de 630pb, fue comparado con secuencias obtenidas desde la base de datos de GenBank (tabla 2). 23 Tabla 2. Cepas de referencia para AVE utilizadas en la comparación del segmento ORF5. Cepa Origen Nº GenBank Grupo Bucyrus USA DQ846750 NA P1 Polonia AF118775 EU-1 A1 Austria U46952 EU-1 ARVAC USA U81019 NA CA97 USA AF118783 EU-2 CDN2 (CAN86) Canadá U81021 NA CW96 USA AY349167 EU-2 ATCC USA U81020 NA I8 (1489V-96) Italia AF099829 EU-1 F15 Francia EF492553 EU-2 F10 Francia EF492548 EU-2 F9 Francia EF492547 EU-1 F5 Francia EF492543 NA G1 Gran Bretaña AF118777 EU-1 LP02/R Argentina DQ435440 EU-1 RSA3 Sudáfrica AY453334 EU-1 J1-931125 Sudáfrica AY956596 EU-2 VBS53 (USA1) USA U81013 NA Donde se indica el nombre de la cepa, origen, número correlativo en base de datos GenBank y grupo al que pertenecen: Norteamericana (NA), Europeo-1 (EU-1) y Europeo- 2 (EU-2). Bucyrus, CDN2, ATCC, VBS53 (Patton et al., 1999); P1, A1, CA97, G1 (Balasuriya et al., 1999); CW96 (Balasuriya et al., 2004b); I8 (Stadejek et al., 1999); ARVAC, F5, F9, F10, F15 (Zhang et al., 2007); LP02/R (Echeverria et al., 2007); RSA3 (Guthrie et al., 2003); J1-931125 (Stadejek et al., 2006) 24

 Al observar la similitud entre las secuencias aminoacídicas con la cepa de referencia Bucyrus (grupo Norteamericano), ésta fue tan sólo de un 64,9%. En tanto, al comparar con las otras cepas de referencia de AVE se observó una similitud que varía entre un 62% y un 78,6%. Del grupo Norteamericano la cepa que tuvo mayor similitud nucleotídica fue CND2 (CAN86) que presentó un 68,5% de homología nucleotídica, en este grupo se encuentra también la cepa vaccinal ARVAC que presentó tan solo un 62,0% de similitud nucleotídica, siendo de las cepas analizadas la que se encuentra más alejada filogenéticamente. En tanto en el grupo Europeo-1, la cepa P1 presentó un 68,0% de similitud nucleotídica, dentro de este grupo también se encuentra la cepa Argentina LP02/R que presentó una similitud aminoacídicas de un 66,7% y una cepa aislada en burros Italianos I8 (1489V-96) con un 67,0% de similitud. En tanto el grupo Europeo2, la cepa J1- 931125 fue la que presento mayor similitud nucleotídica con la cepa Atacama con un 78,6% de similitud. Aminoacídicamente hay una variación de entre 77,7% (cepa vaccinal ARVAC) y 93,1% (cepa J1-931125). En tanto con la cepa de referencia Bucyrus hay una variación de un 81,4% (Figura 6) 25 Figura 6. Porcentaje de similitud de nucleotídica y aminoacídica del segmento parcial de ORF5 de la cepa Atacama con las distintas cepas de referencia de AVE. *comparación nucleotídica; ** comparación aminoacídica. 26 En el árbol filogenético del segmento ORF5 de AVE se observan 3 grupos los que corresponden al grupo Norteamericano, subgrupo Europeo-1 y subgrupo Europeo- 2, dentro de este grupo se encuentran las cepas Atacama y J1-931125, ambas de origen asnal, las que se encuentran filogenéticamente mas alejadas del resto de las cepas de referencia para AVE (figura 7). Figura 7. Árbol Filogenético del segmento parcial ORF5 de AVE. Cepas del grupo Norteamericano (rojo), cepas del subgrupo Europeo-1 (azul), cepas del subgrupo Europeo-2 (amarillo), cepas Asnales del subgrupo Europeo-2 (verde). La cepa atacama presentó mayor similitud tanto aminoacídica como nucleotídica con la cepa J1-931125, esta pertenece al subgrupo europeo 2. Por ello se 27 comparó con distintas cepas pertenecientes a este subgrupo a nivel del segmento ORF5 (Tabla 3). Tabla 3. Cepas de referencia para AVE correspondientes al subgrupo Europeo-2, para la comparación con la cepa Atacama a nivel del segmento ORF5. Cepa Origen Nº GenBank Grupo CA97 USA AF118783 EU2 CW96 USA AY349167 EU2 F15 Francia EF492553 EU2 F10 Francia EF492548 EU2 J1-931125 Sudáfrica AY956596 EU2 S2 Suecia AY453340 EU2 RSA1 Sudáfrica AY453332 EU2 H13 Hungría AY453298 EU2 A9 Austria AY453282 EU2 GB3 (96-7982) Gran Bretaña AF099846 EU2 N3 (NEAV3) Noruega AF099837 EU2 I4 (470VE1-95) Italia AF099825 EU2 D1 (W887) Alemania AF099817 EU2 DK97-5 Dinamarca AF247543 EU2 Se indica el nombre de la cepa, origen, número correlativo en base de datos GenBank. CA97 (Balasuriya et al., 1999); CW96 (Balasuriya et al., 2004b); F15, F10, DK97-5 (Zhang et al., 2007); J1-931125 (Stadejek et al., 2006); S2, RSA1, H13, A9 (Mittelholzer et al., 2006); GB3 (96-7982), N3 (NEAV3), I4 (470VE1-95), D1 (W887) (Stadejek et al., 1999).

 Las similitudes aminoacídicas y nucleotídica de la cepa Atacama con el resto del subgrupo Europeo-2, al igual que en la figura 6 se evidencia que la mayor cercanía es con la cepa J1-931125, esta representa un cluster de cepas asnales sudafricanas además de las cepas J25-941109-3 (Stadejek et al., 2006) y RSA1 (Guthrie et al., 2003), éstas presentan una similitud nucleotídica de un 78,8% y 28 una similitud aminoacídica de un 93,1% con la cepa Atacama. En tanto, la cepa más distante nucleotídicamente es la cepa H13 con un 66,1% de similitud y 83,5% de similitud aminoacídica, seguidas por F10 y F15 con 66,3% y 82,7%; CA97 con 66,7% y 83,5%; D1 con 66,9% y 82,0%; GB3 con 67,3% y 83,5%; NEAV3 con 67,4% y 83,5%; CW96 con 68,0% y 84,2%; I4 con 68,1% y 85,6%; DK97-5 con un 68,3% y 86,3%; A9 con un 68,3% y 84,2% de similitud aminoacídica y nucleotídica respectivamente (Figura 8). 29 Figura 8. Similitud nucleotídica y aminoacídica del segmento ORF5 de la cepa Atacama con las cepas de referencia del subgrupo Europeo-2. *comparación nucleotídica; **comparación aminoacídica. 30 En el árbol filogenético, del subgrupo Europeo-2 se observan 2 grupos formados las cepas de referencia de AVE de origen equino, alejadas de estas las cepas de referencia de origen asnal junto con la cepa Atacama. La cepa RSA1 fue aislada desde equino, pero pertenece al cluster de cepas aisladas de burros en Sudáfrica (Figura 9). Figura 9. Árbol filogenético del segmento ORF5 de las cepas de referencia de AVE pertenecientes al subgrupo Europeo-2. Cepas de origen equino (amarillo), cepas de origen asnal (verde) Al realizar el análisis del segmento parcial de ORF5 de la cepa Atacama con la cepa de referencia Bucyrus, se observaron 128 cambios de nucleótidos a lo largo de todo el segmento ORF5 (Figura 10, Apéndice). Éstos cambios generaron 28 variaciones aminoacídicas a nivel de la proteína GP5 en las posiciones: 61 corresponde a el epítopo neutralizante B que se encuentra en la zona variable V1 (61 – 121aa); cambios en posición 73, 85, 89 y 90 corresponden al epítopo 31 neutralizante C (67 - 90aa) en la zona V1; cambios en el aminoácido 101 corresponden al epítopo neutralizante D (98 - 106aa) en la zona V1; cambios en posición 136 corresponden a la zona conservada C2 (122 – 140); cambios de aminoácidos en la posición 141, 145. 151, 154, 158, 166, 167, 170, 173, 174, 175, 177 y 178, corresponden a la zona variable V2 (141 – 178aa), cambios en la posición 199, corresponden a la zona conservada C3; cambios en aminoácidos posición 207, 211, 214 y 220 corresponden al sector variable V3 (202 – 222aa). En la zona V1, se evidenciaron 6 cambios aminoacídicos, en V2 se evidencian 13 cambios y en zona V3, 4 cambios aminoacídicos. En tanto en las zonas conservadas C1 y C3 se observa 1 cambio aminoacídico por cada zona (Figura 11, Apéndice). En el segmento parcial ORF6 se evidenciaron 37 cambios nucleotídicos (Figura 12, Apéndice). Estos se tradujeron en 7 cambios aminoacídicas en la proteína M (Figura 13, Apéndice). En el segmento parcial ORF7 los cambios nucleotídicos fueron 38 (Figura 14, Apéndice). Estos generaron 6 cambios aminoacídicas a nivel de la proteína N (Figura 15, Apéndice). Además del estudio filogenético, se realizo también aislamiento viral en cultivo celular. Las muestras positivas a la técnica RT-PCR, Conducto Deferente, Próstata y Vesícula Seminal, de estas se logro realizar el cultivo en solo una de ellas correspondiente a la muestra de Conducto Deferente. Esta evidenció efecto citopático a partir del quinto día post-inoculación, el cual se evidencia por una disminución del tapiz celular y circularización de las células. Esto fue confirmado por la técnica RT-PCR (Figura 16).Figura 16: Cultivo celular en células RK-13 (40x) 7 días post-inoculación viral. A: control Negativo. B: células infectadas con AVE.  

VI. DISCUSION

 El virus de la arteritis viral equina genera pérdidas en la producción equina por aborto y reabsorción embrionaria en yeguas e infección persistente en machos (Balasuriya et al., 2014). En Chile, solo se implementaron medidas de mitigación luego del brote en Argentina del año 2010, dictándose la resolución exenta Nº 4615 (2010) para tomar medidas en el ingreso de equinos desde argentina y la pesquisa de los animales que han tenido contacto con equinos o semen de animales que provengan del extranjero, encontrándose dos casos sospechosos positivos a serología, los cuales se mantuvieron en cuarentena para confirmación del diagnostico (SAG, 2010). La Esta investigación efectuada en este trabajo corresponde al primer aislamiento y análisis filogenético de AVE realizado en Chile. Para el análisis filogenético de ORF5, fue posible obtener una secuencia parcial de un tamaño de 630pb, Esta secuencia es la menos conservada dentro del genoma de AVE, razón por la que este segmento es ampliamente utilizado para la clasificación filogenética de AVE y permite discriminar los distintos grupos y subgrupos (Zhang et al., 2007 ). La cepa Atacama, se encuentra muy distante genéticamente de la cepa de referencia Bucyrus con una similitud nucleotídica de 64,9% y una similitud aminoacídica de un 81,4%, lo que la alejaría del grupo Norteamericano al que pertenece Bucyrus. Además, presentó mayor cercanía filogenética con la cepa J1- 931125 (Stadejek et al., 2006), con una similitud nucleotídica de 78,6% y una similitud aminoacídica de 93,1%. Ésta cepa se encuentra muy alejada de los grupos filogenéticos de AVE, pero presentaría cierta cercanía con el subgrupo Europeo-2, donde fue clasificada (Zhang et al., 2007). Con estos antecedentes se clasificaría a la cepa chilena dentro de este subgrupo. El grupo filogenético Norteamericano, presenta cepas distribuidas por Norteamérica, Europa y Oceanía. Éste, siendo conformado por aislados de équidos de las regiones de Canadá, Estados Unidos, Nueva Zelanda, Países 34 Bajos (NL1), Gran Bretaña (GB3)(Stadejek et al., 1999), Hungría (H170S, H172S) (Hornyak et al., 2005), Noruega, Dinamarca (Mittelhozer et al., 2006), las cepas de laboratorio VBS53, ATCC, Bucyrus y la cepa vaccinal ARVAC (Stadejek et al., 1999; Mittelholzer et al., 2006; Zhang et al., 2007; Mertz et al., 2010). El subgrupo Europeo-1, está distribuido por Europa principalmente, compuesto por cepas de Austria, Francia, Italia, Alemania, Gran Bretaña, cepas italianas aisladas desde burros, USA8 y USA18 (Stadejek et al., 1999; Hornyak et al., 2005), Hungría, Dinamarca, Qatar (Mittelholzer et al., 2006),Polonia (Larska y Rola 2008; Surma-Kurusiewicz et al., 2013) cepas aisladas del brote en Estados Unidos del año 2006 y 2007 (Zhang et al., 2010), cepas aisladas en Argentina (Mertz et al., 2010) y las cepas aisladas desde caballos Hucul de Polonia (Rola et al.,2011). Las cepas presentes en el subgrupo Europeo-2 se han aislado en Francia, Italia, Alemania, Noruega (Stadejek et al., 1999; Surma-Kurusiewicz et al., 2013), CW96 y CW01 aislados en Estados Unidos (Balasuriya et al., 2004b), Países Bajos, Dinamarca, Suecia, Hungría, USA52 en Estados Unidos (Mittelholzer et al., 2006), Polonia (Larska y Rola 2008) y Sudáfrica, esta ultima presenta 2 cluster compuesto por cepas aisladas desde potros lipizzanos (Guthrie et al., 2003; Mertz et al., 2010) y otra por asnales a la que pertenecen 2 aislados desde equinos (Stadejek et al., 2006; Guthrie et al., 2003). Lo que demuestra, la posibilidad de que las cepas de asnales silvestres puedan transmitirse libremente a équidos domésticos. No se han reportado brotes de estas cepas en Sudamérica. Argentina, en los casos de AVE observados se han caracterizado cepas como la LP02/R, que presenta una homología nucleotídica de 66,7% y 82,1% aminoacídica con la cepa Atacama y una similitud nucleotídica de 82,3% y aminoacídica de 89,1% con la cepa Bucyrus. LP02/R pertenece a un mismo cluster junto con las cepas argentinas LP01, LP02/P, LP02/C (Echeverría et al., 2007) RO-LP-ARG, RZ-LP-ARG y KB-LP-ARG (Mertz et al., 2008), siendo todas estas clasificadas dentro del grupo Europeo-1 (Mertz et al., 2010). Según la OIE, no se reportan casos de AVE en animales silvestres, en Perú, Bolivia y Argentina (WAHIS, 2015c), pero ésto no podría descartarse por completo debido a la evidencia 35 demostrada con el reciente descubrimiento de la cepa en Chile. Estos son los únicos reportes, lo que podría deberse a que no existen estudios acerca del tema en el continente. Para el segmento ORF7 que codifica para la proteína N (Nucleocápside), es uno de los segmentos más conservados del virus. Corresponde al 30% de las proteínas que conforman el virus. Presenta un sitio N-terminal (1-47 aa), que es el menos conservado y se cree que interactúa con el ARN en el ensamblaje de la Nucleocapside. El sitio C-terminal (49-110 aa) forma un dímero que consiste en una estructura en beta-plegada flanqueada por una alfa-hélice (Snijder et al., 2013; Balasuriya et al., 2013). La cepa Atacama presenta mayor homología nucleotídica en el segmento ORF7 con la cepa F10, 87,2% la que pertenece al subgrupo Europeo-2. Esto no se vio reflejado a nivel aminoacídico, ya que tuvo mayor similitud con las cepas CW01, CW96 pertenecientes al subgrupo Europeo- 2, las cepas F9, G1 y P1 corresponden al subgrupo Europeo-1, estas presentaron una similitud de un 95,9%. Al observar la cepa dentro del árbol filogenético del segmento ORF7, Atacama se encuentra alejada filogenéticamente del resto de las cepas en estudio. El segmento ORF6 codifica para la proteína M, esta es la proteína de membrana más conservada y junto con la proteína GP5 forman el complejo mayor de membrana. Esta proteína carece de sitio de N-glicosilacion y presenta un sitio de unión GP5 mediante un puente disulfuro (S-S) el que se encuentra en posición Cys 8 (M) y Cys 34 (GP5), esta proteína ayuda a plegar la proteína GP5 y de esta forma presentar los epítopes neutralizantes (Balasuriya et al., 2013). De las cepas de referencia analizadas, presentaría mayor similitud con la cepa F9, un 79,8 y 88,4% de similitud nucleotídica y aminoacídica respectivamente, que corresponde al subgrupo Europeo-1. Al observar el árbol filogenético de ORF6 La cepa Atacama se observa muy alejada del resto de las cepas de referencia en estudio, lo que podría deberse a que es una cepa de origen asnal. El segmento ORF5 codifica para la proteína GP5, que es la proteína de envoltura más abundante de AVE (Snijder et al., 2013), presentando mayor variabilidad 36 dentro de las proteínas del virus, ya que ésta, presenta los epítopes neutralizantes y está en constante presión por el sistema inmune del hospedador estimulando la producción de anticuerpos neutralizantes (Balasuriya et al., 2013). Presenta 2 sitios N-glicosilacion, Asn56 y Asn 81. Un ectodominio que contiene 95 aminoácidos (aa) en donde del aa 1 al 18 corresponde al sitio N-terminal. Los anticuerpos monoclonales neutralizantes contra AVE se unen al ectodominio de GP5 (19-115 aa). Esta proteína contiene 3 zonas conservadas en las que se encuentra C1 (19-60), C2 (122-140) y C3 (179-201) y 3 zonas variables V1 (61- 121), V2 (141-178) y V3 (202 -222). Además, presenta 4 sitios principales de neutralización: A (49 aa), B (61aa), C (67-90aa) y D (98-106aa). En donde A se encuentra dentro de C1 y desde B a D se encuentran en la zona hipervariable V1 (Balasuriya et al., 1995a). A nivel del segmento ORF5, la cepa Atacama presenta mayor similitud nucleotídica (78,6%) y aminoacídica (93,1%) con la cepa J1- 931125, perteneciente a un clúster conformado por cepas aisladas en Sudáfrica desde asnales: J2-931125, J3-931209, J4-931209, J6-940309, J7-931125 (Stadejek et al., 2006), y desde caballos: J25-941103-3 (Stadejek et al., 2006) y RSA1(Guthrie et al., 2003). En contraste, las cepas 1489V-96 (I8) y 3308V-96 (I9) (Stadejek et al., 1999) fueron aisladas desde burros en Italia, pero éstas no presentan relación filogenética con las cepas Atacama y J1-931125, ya que presenta una cercanía nucleotídica de 81,3% y aminoacídica de 89,8% con la cepa de referencia, clasificándolas dentro del subgrupo Europeo-1. Se descartaría el ingreso de la cepa desde Argentina, ya que presenta una considerable divergencia filogenética, por lo que se postula que en Chile existe una cepa ancestral, la que se ha mantenido circulante dentro de la población de burros de la Región como una infección endémica. El uso de los segmentos ORF6 y ORF7 no serían confiables para la clasificación filogenética de las cepas de AVE dentro de un cluster, ya que al ser segmentos más conservados tienen menos variaciones genéticas (Larska y Rola 2008; Rola et al., 2013), lo que no permite discriminar entre cepas de cercanas filogenéticamente. En el caso de cepas que presentan mayor distancia genética, presenta cierta fiabilidad, ya que se conservan los grupos filogenéticos de AVE, 37 como sucede en este estudio. En el caso del segmento ORF5, por su alta variabilidad genética es más confiable para realizar clasificación filogenética, ya que nos permite determinar con mayor certeza la identidad viral (Stadejek et al., 1999; Mittelholzer et al., 2006; Zhang et al., 2007; Larska y Rola 2008). Para el diagnóstico de la enfermedad la prueba estándar utilizada por la OIE es la seroneutralización, para ello se utiliza la cepa Bucyrus como antígeno (OIE, 2013). Esta cepa tiene una divergencia de un 35,1 % a nivel nucleotídico, lo que se traduce en una variación aminoacídica del 18,6% para la proteína GP5. Esta proteína es la principal estimuladora del sistema inmune, ya que es la que está en contacto con éste y es contra la que se presentan los anticuerpos neutralizantes. Con estos datos se recomendaría evaluar la capacidad de diagnóstico en Chile, mediante el uso de la cepa Bucyrus para la infección con la cepa Atacama, ya que la técnica debido a sus diferencias genéticas podría presentar menor sensibilidad, lo que generaría un considerable número de individuos falsos negativos. Sería una opción a considerar, implementar otra técnica diagnostica con la cepa presente en el país, como se realizó en Argentina a través del desarrollo de un test de ELISA propio (Mertz et al., 2014). En el caso de la cepa vaccinal ARVAC, que es mundialmente utilizada para la inmunización de contra AVE, presento una similitud nucleotídica de un 62,0% y aminoacídica 77,7% con respecto a la cepa Atacama. En el caso de la inmunidad otorgada por la vacuna, sería recomendable evaluar la protectividad cruzada de ésta, ya que presenta una variación mayor al 20% con la cepa Atacama en relación a la proteína GP5, como se mencionó anteriormente, ésta es proteína la que estimula la respuesta inmune contra AVE, por ello si se quisiera controlar con vacunación la opción más válida sería sintetizar vacunas con la cepa actuante en Chile, ya que en el caso de erradicación de la enfermedad no es recomendable vacunar. En este estudio además se logro aislar la cepa Atacama en cultivo celular, este aislado podría utilizarse para estudios futuros acerca del diagnóstico y la 38 elaboración de vacunas con el fin de un control más acertado de la enfermedad y erradicación de esta. Los antecedentes planteados en la hipótesis hacen suponer que la cepa Atacama, es distinta a las presentes en caballos, sería una cepa asnales silvestres nueva de no descrita en la literatura. Existe evidencia científica de que estas cepas silvestres como es el caso de la cepa Chilena, pueden infectar a équidos domésticos (Guthrie et al., 2003; Stadejek et al., 2006), lo que representaría un potencial riesgo para la población de equinos del país. 39

 VII. CONCLUSIONES

 1. Se logóaislar el virus de la arteritis viral equina a partir de las muestras serológicamente positivas provenientes de la Región de Atacama. 2. Fue posible realizar diagnostico de arteritis viral equina, de los aislados celulares mediante la técnica RT-PCR, para los segmentos ORF6 y ORF7. 3. A través de la secuenciación genética de los segmentos ORF5, ORF6 y ORF7 fue posible caracterizar una cepa actuante en los aislados de arteritis viral equina. 4. La cepa Chilena pertenecería al subgrupo Europeo-2 de arteritis viral equina, la que sería una novel cepa no descrita anteriormente en la literatura

.VIII. REFERENCIAS BIBLIOGRAFICAS

 1. Asagoe T, Y Inaba, E Jusa, M Kouno, K Uwatoko, Y Fukunaga. 1997. Effect of heparin on infection of the cells by Equine Arteritis Virus. J. Vet. Med. Sci. 59 (8): 727 – 728. 2. Balasuriya U, N MacLachlan, A de Vries, P Rossitto, P Rottier. 1995a. Identification of a Neutralization site in the major envelope glycoprotein (Gl) of Equine Arteritisvirus. Virology. 207: 518 – 527. 3. Balasuriya U, P Timoney, W McCollum, J MacLachlan. 1995b. Short Communication: Phylogenetic Analysis of Open Reading Frame 5 of Field Isolates of Equine Arteritis Virus and Identification of Conserved and Nonconserved Regions in the GL Envelope Glycoprotein. Virology. 214: 690 – 697. 4. Balasuriya U, J Patton, P Rossitto, P Timoney, W McCollum, N McLachlan. 1997. Neutralization Determinants of Laboratory Strains and Field Isolates of Equine Arteritis Virus: Identification of Four Neutralization Sites in the Amino-Terminal Ectodomain of the GL Envelope Glycoprotein. Virology. 232: 114 – 128. 5. Balasuriya U, J Hedges, S Nadler, W McCollum, P Timoney, N MacLachlan. 1999. Genetic stability of Equine arteritis virus during horizontal and vertical transmission in an outbreak of equine viral Arteritis. Journal of General Virology. 80: 1949 – 1958. 6. Balasuriya U, C Leutenegger, J Topol, W McCollum, P Timoney, N MacLachlan. 2002. Detection of Equine Arteritis Virus by real-time TaqMan® reverse transcription-PCR assay. Journal Virology Methods. 101: 21 – 28. 41 7. Balasuriya U, J Dobbe, H Heidner, V Smalley, A Navarrette, E Snijder, N MacLachlan. 2004a. Characterization of the neutralization determinants of Equine Arteritis Virus using recombinant chimeric viruses and site-specific mutagenesis of an infectious cDNA clone. Virology. 321: 235 – 246. 8. Balasuriya U, J Hedges, V Smalley, A Navarrette, W McCollum, P Timoney, E Snijder, N McLachlan. 2004b. Genetic characterization of Equine Arteritis Virus during persistent infection of stallion. Journal of General Virology. 85: 379 – 390. 9. Balasuriya U, Y Go, N MacLachlan. 2013. Equine Arteritis Virus. Veterinary Microbiology. 167: 93 – 122. 10.Balasuriya U. 2014. Equine Viral Arteritis. Vet. Clin. Equine. 30: 543 – 560. 11.Chung C, C Wilson, P Timoney, U Balasuriya, E Adams, D Adams, J Evermann, A Clavijo, K Shuck, S Rodgers, S Lee, T McGuire. 2013. Validation of an improved competitive enzyme-linked immunosorbent assay to detect Equine Arteritis Virus antibody. Journal of Veterinary Diagnostic Investigation. 25 (6): 727– 735. 12.de Vries A, E Chirnside, M Horzinek, P Rottier. 1992. Structural protein of Equine Viral Arteritis. Journal of Virology. 66 (11): 6294 – 6303. 13.de Vries A, M Horzinek, P Rottier, R de Groot. 1997. The Genome Organization of the Nidovirales: Similarities and Differences between Arteri-,Toro-, and Coronaviruses. Virology. 8: 33 – 47. 42 14. Decreto N º389 Exento. establece enfermedades de declaración obligatoria para la aplicación de medidas sanitarias y deroga decretos que indica. 21 Noviembre 2014. Santiago, Chile. 15.Del Piero F. 2000. Equine Viral Arteritis. Vet. Pathol. 37: 287 – 296. 16.Deshpande A, S Wang, M Walsh, T Dokland. 2007. Structure of the Equine Arteritis Virus nucleocapsid protein reveals a dimer – dimer arrangement. Acta Cryst. 63: 581-586. 17.Doll E, J Bryans, M Crowe, W McCollum. 1957. Isolation of a filterable agent causing Arteritis of horses and abortion by mares; its differentiation from the equine abortion (influenza) virus. Cornell Vet. 47 (1): 3 – 41. 18.Dunowska M, P Biggs, T Zheng, M Perrot. 2012. Identification of a novel nidovirus associated with a neurological disease of the Australian brushtail possum (Trichosurus vulpecula). Veterinary Microbiology. 156: 418 – 424. 19.Echeverria M, S Diaz, G Mertz, M Serena, C Panei, E Nosetto. 2007. Genetic typing of Equine Arteritis Virus isolates from Argentina. Virus Genes. 35: 313 – 320. 20.Firth A, J Zevenhoven-Dobbe, N Wills, Y Go, U Balasuriya, J Atkins, E Snijder, C Posthuma. 2011. Discovery of a small Arterivirus gene that overlaps the GP5 coding sequence and is important for virus production. Journal of General Virology.92: 1097 – 1106. 43 21.Fuentealba J. 2010. Informe de actividades de avance de vigilancia sobre Arteritis Viral Equina. pp: 1-14. Servicio Agricola y Ganadero, Subdepartamento de Vigilancia Epidemiológica, División de Protección Pecuaria. Santigo, Chile. 22.Glaser A, A de Vries, P Rottier, M Horzinek, B Colenbrander. 1996. Equine Arteritis Virus: A review of clinical features and management aspect. Vet Quart. 18: 95 – 99. 23.Glaser A, E Chirnside, M Horzinek, A de Vries. 1997. Equine Arteritis Virus. Theriogenology. 47: 1275 – 1295. 24.Go Y, R Cook, J Fulgencio, J Campos, P Henney, P Timoney, D Horohov, U Balasuriya. 2012. Assessment of correlation between in vitro CD3+ T cell susceptibility to EAV infection and clinical outcome following experimental infection. Veterinary Microbiology. 157: 220 – 225. 25.Gorbalenya A, L Enjuanes, J Ziebuhr, E Snijder. 2006. Nidovirales: Envolving the largest RNA virus genome. Virus Researsh. 117: 17 – 37. 26.Guthrie A, P Howell, J Hedges, A Bosman, U Balasuriya, M McCollum, P Timoney, N MacLachlan. 2003. Lateral Transmission on the Equine Arteritis Virus among Lipizzaner stallion in South Africa. Equine Vet. J. 35 (6): 596 – 600. 27.Holyoak G, U Balasuriya, C Broaddus, P Timoney. 2008. Equine Viral Arteritis: Current status and prevention. Theriogenology.70: 403 – 414. 44 28.Hornyak A, T Bakonyi, G Tekes, L Szeredi, M Rusvai. 2005. A novel subgroup among genotypes of Equine Arteritis Virus: genetic comparison of 40 strains. J. Vet. Med. 52: 112 – 118. 29.Hullinger P, I Gardner, S Hietala, G Ferraro, J MacLachlan. 2001. Seroprevalence of antibodies against equine Arteritis virus in horses residing in the United States and imported horses. JAVMA. 219 (7): 946 – 949. 30.Instituto Nacional de Estadísticas. 2014. Censo agropecuario y forestal 2007. [en línea] INE. http://www.ine.cl. [Consulta: 16 diciembre 2015]. 31.Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16 (2): 111 – 120. 32.Larkin M, G Blackshields, N Brown, R Chenna, P McGettigan, H McWilliam, F Valentin, I Wallace, AWilm, R Lopez, J Thomson, T Gibson, D Higgins. 2007. Clustal W and Clustal X versión 2.0.Bioinformatics. 23(21): 2947- 2948. 33.Larska M, J Rola. 2008. Molecular epizootiology of Equine Arteritis Virus Isolates from Poland. Veterinary Microbiology.127: 392 – 398. 34.Liu L, J Castillo-Olivares, N Davis-Poynter, C Baule, H Xia, S Belak. 2008. Analysis of ORFs 2b, 3, 4, and partial ORF5 of sequential isolates of Equine Arteritis Virus shows genetic variation following experimental infection of horses. Veterinary Microbiology. 129: 262 – 268. 45 35.McFadden A, P Pearce, D Orr, K Nicoll, T Rawdon, H Pharo, M Stone. Evidence for absence of Equine Arteritis Virus in the horse populations of New Zealand. New Zealand Veterinary Journal. 61(5): 300 – 304. 36.McLachland N, U Balasuriya, P Rossitto, P Hullinger, J Patton, W Wilson. 1996. Fatal experimental equine Arteritis virus infection of a pregnant mare: immunohistochemical staining of viral antigens. J. Vet. Diag. Invest. 8: 367 – 374. 37.Metz G, M Serena, S Díaz, M Echeverría. 2008. Caracterización de secuencias del virus de la Arteritis Equina obtenidas directamente de muestras de semen de equinos seropositivos. Analecta Veterinaria. 28 (2): 21 – 26. 38.Mertz G, G Martin, M Serena, S Gambaro, E Nosetto, M Echeverria. 2010. Extended phylogeny of the equine arteritis virus including South American sequences. Intervirology. 54: 30 – 36. 39.Mertz G, E Lorenzon, M Serena, S Corva, C Panei, S Diaz, E Cilli, M Echeverria. 2014. Development of a peptide ELISA for the diagnosis of Equine Arteritis Virus. Journal of Virological Methods. 205 : 3–6. 40.Mishra N, R Dubey, K Rajukumar, C Tosh, ATiwari, S Pitale, H Pradhan. 2007. Genetic and antigenic characterization of bovine viral diarrea virus type 2 isolated from Indian goats (Capra hircus). Veterinary Microbiology. 124: 340 – 347. 41.Mittelholzer C, T Stadejek, I Johansson, C Baule, I Ciabatti, D Hannant, D Paton, G Autorino, N Nowotny, S Belak.2006. Extended 46 phylogeny of Equine Arteritis Virus: division into new subgroups. J. Vet. Med. 53: 55 – 58. 42.Miszczak F, K Shuck, Z Lu, Y Go, J Zang, S Sells, A Vabret, S Pronost, G Fortier, P Timoney, U Balasuriya. 2011. Evaluation of two Magnetic-Bead-Based Viral Nucleic Acid Purification Kits and three Real-Time Reverse Transcription-PCR Reagent Systems in two TaqMan Assays for Equine Arteritis Virus detection in semen. Journal Of Clinical Microbiology. 49 (10): 3694 – 3696. 43.Moreira R, A García, V Moreno, J Valencia. 2014. Arteritis viral equina en Burros (Equus asinus) asilvestrados de la Región de Atacama, Chile. XVIII Congreso Chileno de Medicina Veterinaria. 01-02-03 diciembre 2014. Universidad de Chile. Facultad de Ciencias Veterinarias y Pecuarias. Santiago, Chile. 44.Organización Internacional de Epizootias. 2013. Arteritis Viral Equina. Capítulo 2.5.10. 45.Patton J, U Balasuriya, J Hedges, T Schweidler, P Hullinger, N MacLachlan. 1999. Phylogenetic characterization of a highly attenuated strain of Equine arteritis virus from the semen of a persistently infected Standardbred stallion. Archives of Virology. 144: 817 – 827. 46.Resolución Exenta Nº 4138. Establece zona de control sanitario de arteritis viral equina en población de Équidos. Diario Oficial de la República de Chile. 6 noviembre 2014. Santiago, Chile. 47.Resolución Exenta Nº 4615 (Derogado). Aplica medidas de mitigación en Forma Transitoria a la integración de équidos que indica al país. Diario Oficial de la República de Chile. 18 agosto 2010. 47 48.Rola J, M Larska, J Rola, S Belak, G Autorino. 2011. Epizootiology and phylogeny of Equine Arteritis Virus in Hucul horses. Veterinary Microbiology. 148: 402 – 407. 49.Rola J, W Socha, J Zmudzinski. 2013. Sequence analysis of ORFs 5, 6 and 7 of Equine Arteritis Virus during persistent infection of the stallion—A 7-year study. Veterinary Microbiology. 164: 378 – 382. 50.Saitou N, M Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic tres. Mol. Biol. Evol.4(4): p. 406- 425. 51.Servicio Agrícola y Ganadero. 2014. Minuta Arteritis Viral Equina (AVE) 52.Servicio Agricola y Ganadero. 2015. Lista de enfermedades de denuncia Obligatoria (EDO) al SAG. [pdf]. . [28 de Julio de 2015] 53.Snijder E, J Meulenberg. 1998. The molecular biology of Arteriviruses. Journal of General Virology. 79: 961 – 979. 54.Snijder E, K Marjolein, Y Fang. 2013. Arterivirus molecular biology and pathogenesis. Journal of General Virology.94: 2141 – 2163. 55.Stadejek T, H Bjôrklund, C Bascuñana, I Ciabatti, M Scicluna, D Amaddeo, W McCollum, G Autorino, P Timoney, D Paton, B Klingeborn, S Belak. 1999. Genetic diversity of Equine Arteritis Virus. Journal of General Virology.80: 691 – 699. 48 56.Stadejek T, C Mittelholzer, M Oleksiewicz, J Paweska, S Belak. 2006. Highly diverse type of Equine Arteritis Virus (EAV) from the semen of the south African donkey: Short communication. Acta Veterinaria Hungarica. 54 (2): 263 – 270. 57.Surma-Kurusiewicz K, S Winiarczyk, L Adaszek. 2013. Comparative analysis of ORF5 nucleotide sequences and amino acid sequences of the GP5 protein of Equine Arteritis Virus (EAV) detected in the semen of stallions from Eastern Poland. Research In Veterinary Science. 94: 361–367. 58.Timoney P, W McCollum. 1987. Equine Viral Arteritis. Can. Vet. J. 28: 693 – 695. 59.Timoney P, W McCollum. 1988. Equine Viral Arteritis – Epidemiology and control. Equine Veterinary Science.8 (1): 54 – 59. 60.Timoney P, W McCollum. 1996. Equine Viral Arteritis. Equine vet. Educ. 8 (2): 97 – 100. 61.Vaala W, A Hamir, E Dubovit, P Timoney, B Ruiz. 1992. Fatal, congenitally acquired infection with Equine Arteritis Virus in a neonatal Thoroughbred. Equine Vet. J. 24 (2): 155 – 158. 62.Wagner H, U Balasuriya, N MacLachlan. 2003. The serologic response of horses to Equine Arteritis Virus as determined by competitive enzyme-linked immunosorbent assays (c-ELISAs) to structural and non-structural viral proteins. CIMID. 26: 251 – 260. 49 63.WAHIS Interface. 2015. Country Information: Chile, Animal health situation: 2013. [En línea]. OIE World Animal Health Information System. . [Consulta: 28 diciembre 2015]. 64.WAHIS Interface. 2015b. Disease Control Measures, Country: Chile, Disease: Equine Viral Arteritis. [En línea]. OIE World Animal Health Information System. . [Consulta: 28 diciembre 2015]. 65.WAHIS Interface. 2015c. Disease distribution maps, equine viral Arteritis, 2013. [En línea]. OIE World Animal Health Information System. . [Consulta: 28 diciembre 2015]. 66.Wescott D, D King, T Drew, N Nowotny, J Kindermann, D Hannant, S Belak, D Paton. 2003. Use of an internal standard in a closed onetube RT-PCR for the detection of Equine Arteritis Virus RNA with fluorescent probes. Vet. Res. 34: 165 – 176. 67.Wieringa R, A de Vries, J van der Meulen, G Godeke, J Onderwater, H van Tol, H Koerten, A Mommaas, E Snijder, P Rottier. 2004. Structural protein requirements of Equine Arteritis Virus assembly. Journal of Virology. 78 (23): 13019 – 13027. 68.Zhang J, F Miszczak, S. Pronost, C Fortier, U Balasuriya, S Zientara, G Fortier, P Timoney. 2007. Genetic variation and phylogenetic analysis of 22 French isolates of Equine Arteritis Virus. Arch. Virol. 152: 1977 – 1994. 50 69.Zhang J, P Timoney, K Shuck, G Seoul, Y Go, Z Lu, D Powell, B Meade. 2010. Molecular epidemiology and genetic characterization of equine Arteritis virus isolated associated with the 2006 – 2007 multi-state disease occurrence in the USA. Journal of General Virology. 91: 2286 – 2301.

No hay comentarios:

Publicar un comentario en la entrada