lunes, 20 de junio de 2016

LENGUA AZUL Saergeman et al 2008

Lengua Azul en el norte de Europa

Editado por Claude Saegerman, Francisco Reviriego-Gordejo y Paul-Pierre Pastoret Publicado por la Organización Mundial de Sanidad Animal (OIE), París y la Unidad de Epidemiología y Análisis de Riesgos aplicados a las Ciencias Veterinarias, Departamento de Enfermedades Infecciosas y Parasíticas, Facultad de Medicina Veterinaria, Universidad de Lieja

1 LENGUA AZUL: INTRODUCCIÓN GENERAL Claude Saegerman Facultad de Medicina Veterinaria, Universidad de Lieja, Bélgica Francisco Reviriego-Gordejo Comisión europea, Dirección General de Sanidad y Consumo, Bruselas, Bélgica Paul-Pierre Pastoret Organización Mundial de Sanidad Animal, París, Francia Hasta el año 2006 la distribución geográfi ca de virus de la lengua azul se extendía entre los 50º de latitud norte y los 35º de latitud sur (2). El virus de la lengua azul (VLA) se descubrió por primera vez en el norte de Europa el 14 de Agosto de 2006. Estaban afectados Alemania, Bélgica, Holanda y, en menor medida, Luxemburgo y Francia. Se identifi caron el serotipo 8 del VLA y dos vectores biológicos autóctonos, Culicoides dewulfi y complejo C. obsoletus. La enfermedad se propagó rápidamente y el 1 de Febrero de 2007 ya se habían identifi cado 2.122 brotes de lengua azul. Resultó inusual que la enfermedad afectase tanto a ganado ovino como bovino. Tras un periodo de remisión, el VLA (mismo serotipo) reapareció en el verano de 2007 (3), lo que refuerza la teoría de que el VLA podría llegar a ser enzoótico en estas regiones. La gama de huéspedes modifi cada y las diferencias del cuadro clínico del VLA en Europa del Norte, plantean preguntas acerca de la patogénesis, la dinámica de la infección en los rebaños afectados (brotes, resurgimiento y difusión), y el desarrollo de un sistema efi caz de detección precoz de enfermedades transmitidas por vectores. 1 2 Debido a su proximidad al epicentro del brote en el norte de Europa, un equipo multidisciplinar de la Facultad de Medicina Veterinaria de la Universidad de Lieja, Bélgica, llevó a cabo un seguimiento clínico transversal y longitudinal de los rodeos de ganado rumiante infectados. Este seguimiento se basó en una plantilla de informe clínico estandarizada (con fotos). Las observaciones clínicas en el ganado vacuno habían sido infrecuentes hasta ese momento. Por eso, se consideró que una monografía científi ca describiendo el episodio de VLA sería de gran importancia para veterinarios y profesionales sanitarios que trabajen en detección precoz de VLA y de enfermedades emergentes en general. Si se pierde una oportunidad de detección precoz, puede no detectarse un brote hasta que la multiplicación y la transmisión del patógeno estén tan avanzadas que resulte muy difícil de controlar. Además, la globalización y el cambio climático son dos condiciones que propician el brote. Compartir las experiencias entre los países pertenecientes a la Asociación Mundial de Sanidad Animal ayuda a aumentar la concienciación de los veterinarios y los profesionales sanitarios, con el fi n de mejorar la detección precoz de enfermedades emergentes.


3 LENGUA AZUL: VIROLOGÍA, PATOGÉNESIS Y BIOLOGÍA DEL VECTOR CULICOIDE Etienne Thiry Facultad de Medicina Veterinaria, Universidad de Lieja, Bélgica Jean-Yves Zimmer Facultad Agricultural de Gembloux, Universidad de Lieja, Bélgica Eric Haubruge Facultad Agricultural de Gembloux, Universidad de Lieja, Bélgica

INTRODUCCIÓN La lengua azul (LA) es una enfermedad no contagiosa transmitida por vectores. El virus causante (VLA) pertenece al género Orbivirus de la familia Reoviridae. La infección suele ser asintomática en el ganado vacuno, que puede actuar como reservorio del virus. Sin embargo, algunos serotipos, como el serotipo 8, que causó infección en el norte de Europa recientemente, exhiben mayor virulencia en los bovinos que en el pasado (20). El ganado ovino es aún el hospedador más importante del virus pero la infección también se da de manera asintomática en rumiantes silvestres, ganado bovino y cabras. Las razas locales de ovejas son normalmente más resistentes que otras a la infección viral. Los cervidos también pueden ser infectados por un orbivirus estrechamente relacionado responsable de la enfermedad hemorrágica epizoótica. Los insectos vectores de la LA son los mosquitos Culicoïdes (14, 15). 2 4 El VLA contiene dos cápsides que envuelven un núcleo que consiste en 10 segmentos de RNA bicatenario que codifi can 7 proteínas estructurales (VP1 a VP7) y 4 proteínas no estructurales (NS1 a NS3, NS3A). La cápside externa contiene las proteínas VP5 y VP2, involucradas en la neutralización del virus y responsables de la especifi cidad del serotipo. La cápside interna está formada por la proteína VP7, que es el antígeno específi co del grupo. La proteína VP1 está presente en el núcleo del virus y es la polimerasa viral del RNA. El genoma está segmentado y pueden darse intercambios de segmentos génicos durante las co-infecciones. Además, el genoma viral tiene una alta tasa de mutaciones que contribuyen a la deriva antigénica. La variabilidad genética del VLA, existen 24 serotipos, se debe a estas características. Entre estos 24 serotipos, los serotipos 1, 2, 4, 9 y 16 se encontraron en la Europa Mediterránea entre 1998 y 2006 (15). El serotipo 8 fue el responsable del brote en Europa del Norte en 2006 y 2007 (21). Se sospecha la existencia de un serotipo 25 (*).

 PATOGÉNESIS El virus persiste en los Culicoïdes durante su vida. Después de una ingesta de sangre, el virus pasa a través de la pared intestinal del insecto y se distribuye por el hemocele a varios tejidos y a las glándulas salivares, donde continúa replicándose. Posteriormente, se excreta en la saliva del insecto. La transmisión viral ocurre, por tanto, principalmente mediante la picadura del insecto. El vector alcanza su máxima capacidad de infección 10 días después de haber absorbido sangre de un animal virémico. Después de que un animal es infectado por la picadura de un insecto, el VLA se replica en los nódulos linfáticos regionales. Se disemina e infecta el endotelio vascular y los macrófagos así como las células dendríticas de (*) Hofmann M.A., Renzullo S., Mader M., Chaignat V., Worwa G. & Thuer B. (2008). – Genetic characterization of Toggenburg orbivirus, a new bluetongue virus, from goats, Switzerland. Emerg. Infect. Dis., 14 (12), 1855-1861. 5 diversos órganos. En la sangre, el virus se adsorbe en la superfi cie de los eritrocitos y las plaquetas y se replica en los monocitos y linfoblastos. El virus infeccioso se encierra en las invaginaciones de la membrana plasmática de los eritrocitos y linfocitos y eso explica la viremia en presencia de anticuerpos neutralizadores. En las ovejas, el período medio de incubación es de 6 a 8 días (intervalo de 2 a 18 días). Se sospecha que el período de incubación es el mismo en ganado bovino y ovino. La patogénesis puede variar según el serotipo del virus y la especie de rumiante. Existe una gran diferencia en la manifestación de la enfermedad entre el ganado ovino y bovino, lo que puede deberse a que las células endoteliales respondan de manera distinta: a diferencia del ganado ovino, el ganado bovino suele desarrollar solamente una infección subclínica a excepción de la infección con el serotipo 8 como ha ocurrido en el norte de Europa. En el ganado ovino, las lesiones en las células endoteliales de los vasos sanguíneos pequeños provocan trombosis vascular y necrosis isquémica del tejido afectado. Estas lesiones resultan en úlceras bucales, infl amación de la banda coronaria, necrosis muscular y extravasación que dan lugar a edema facial y pulmonar y efusión pleural y pericardial (8, 9). Una viremia de larga duración asociada a células, es característica de la LA. La viremia libre es transitoria. El alto nivel de infección viral y la viremia de larga duración aumentan el riesgo de infección de los vectores Culicoïdes. Los anticuerpos neutralizantes aparecen 14 días después pero no eliminan el virus, que está protegido por su asociación con las células sanguíneas. Al comienzo de la viremia, el virus se asocia con varias células sanguíneas. Posteriormente, la viremia está casi exclusivamente asociada con los eritrocitos. Estas células no contienen, sin embargo, la maquinaria necesaria para la replicación viral (8). 6 La infección del virus de la lengua azul no es persistente. La duración de la viremia está asociada en parte con la vida media de los eritrocitos y, por tanto, la viremia dura más en ganado bovino que ovino. En condiciones experimentales, la viremia dura entre 14 y 45 días en ovejas y 31 días en cabras. Para detectar el genoma viral se usa la transcripción reversa de la reacción en cadena de la polimerasa (TR-RCP). Con esta técnica, la viremia se detecta durante un período mucho mayor que el de la viremia infectante. La duración de la viremia, capaz de infectar a los vectores hematófagos, es de unos 60 días. En condiciones de campo, la duración es mucho más corta. En la mayoría de los casos la viremia dura menos de 60 días en el ganado bovino y es por tanto más larga que en ganado ovino. Puede que los toros infectados excreten el virus en esperma y se conviertan en portadores durante un período largo (9). Además de la transmisión por vectores de insectos, el VLA puede ser transmitido verticalmente in útero. Esporádicamente ocurren casos de aborto y malformaciones fetales en rumiantes debidos al VLA. La transmisión transplacental del virus produce signos clínicos variables dependiendo del período de gestación en el que se produzca la infección. Durante el primer tercio del período de gestación, puede producir la muerte del embrión y del feto. La infección durante el segundo tercio del período de gestación puede provocar malformaciones congénitas como hidroencefalia y displasia de la retina, que se deben a la destrucción de precursores neuronales y gliales causada por el virus antes de que estas células emigren a distintas áreas del cerebro. Durante el último tercio de la gestación, el feto desarrolla una respuesta inmune y elimina la infección. Los casos de aborto son poco corrientes comparados con los casos de malformaciones congénitas. Algunos abortos son inespecífi cos y son consecuencia del estrés de la infección en la oveja madre (10). 7 Los vectores competentes comprenden: el Culicoïdes imicola en África y Europa Mediterránea, C. sonorensis en Norte América, C. insignis y pusillus en América del Sur, y C. brevitarsis en Australia (14). En Europa, se han identifi cado C. obsoletus y scoticus en Italia y C. pulicaris en Sicilia. En el norte de Europa, se reconoce a C. dewulfi como vector (11). La lengua azul tiene lugar tras la introducción de vectores u ovejas infectadas en un área libre de virus donde el vector es autóctono. La infección subclínica ocurre habitualmente en ganado bovino y cabras y estas especies pueden servir como reservorio para la infección. Cuando la enfermedad es enzoótica, los signos clínicos se observan principalmente en las ovejas importadas susceptibles a la infección. La distribución geográfi ca del virus depende de la presencia de vectores Culicoïdes. La enfermedad es, por tanto, estacional y se da normalmente en áreas calurosas y húmedas cerca de aguas estancadas. Es posible que se descubran otros vectores Culicoïdes. En regiones de clima templado, la enfermedad brota principalmente al fi nal del verano o principio del invierno, mientras que en áreas subtropicales se da principalmente en primavera o al comenzar el verano pero puede darse también durante todo el año (14). En ausencia de una transmisión transovárica en los insectos, se han sugerido otros mecanismos para explicar el fenómeno de la hibernación, esto es, la supervivencia del virus durante el período invernal y durante entre 9 y 12 meses en ausencia de vectores adultos. Tal mecanismo dependería del establecimiento de infecciones crónicas en ganado ovino y bovino. En este contexto, se sabe que los linfocitos γδ están asociados a una infección persistente en las ovejas (19).

8 VECTORES DE LA LENGUA AZUL: LOS MOSQUITOS CULICOIDES Los mosquitos del género Culicoïdes son pequeños insectos (1-4 mm de largo) dípteros y picadores que pertenecen a la familia de los ceratopogonidae (Fig. 1). Se encuentran desde los trópicos hasta en la tundra y desde el nivel del mar hasta en una altitud de 4.000 m. Tienen un reconocido rol como vector de enfermedades virales y parasitarias de humanos y, sobre todo, de animales (Cuadro I). Dada su abundancia, los Culicoïdes pueden tener un efecto perjudicial debido al daño causado por la picadura de los mosquitos hembra. Su presencia puede difi cultar el crecimiento económico de algunas áreas bloqueando las actividades agrícolas y el desarrollo del turismo. Es más, han estado implicados en brotes de enfermedades virales, incluyendo dos enfermedades animales graves, la enfermedad peste equina y la LA (5). Figura 1: Comparación de la medida de un mosquito picador (Culicoïdes scoticus) (a la izquierda) y un mosquito (Culex sp.) (a la derecha), ambas hembras En la mayoría de las especies Culicoïdes, las hembras adultas son hematófagas; toman una ingesta de sangre cada 3 ó 4 días aproximadamente (1) y se encuentran normalmente a nivel del suelo, cerca de los animales (17). 1 cm 9 Algunas especies son antropofílicas (C. obsoletus y C. impunctatus, por ejemplo) mientras que otras prefi eren alimentarse de ganado (ovejas, cabras, vacas) o pájaros. La mayoría de las especies de mosquitos picadores son activas y por lo tanto pican, al caer la tarde y durante la noche; sin embargo, algunos mosquitos prefi eren picar a plena luz del día. (C. nubeculosus, por ejemplo). Los mosquitos macho viven generalmente en las fl ores (6): se alimentan de néctar, azúcar y polen así como de líquidos provenientes de la descomposición de materia orgánica (3). Por eso, es más fácil encontrar a los machos en la copa de los árboles (4, 17). Las larvas de mosquito se alimentan de una gran variedad de materia orgánica o son depredadores de nematodos, bacterias, protozoos e incluso de individuos de la misma especie (4). Cuadro I: Especies humanas y animales afectadas por ciertas especies de mosquitos picadores (23) Culicoïdes Especies afectadas Humanos Bovino Ovino Caprino Equidos Especies silvestre Aves C. imicola C. milnei C. nubeculosus C. obsoletus C. brevitarsis C. insignis C. fulvus C. actoni C. variipennis C. riethi C. impunctatus C. circumscriptus C. festivipennis 10 La mayoría de las especies Culicoïdes requieren un medio húmedo para reproducirse e incubar sus huevos. De hecho, el desarrollo de las larvas es óptimo en microhábitats semi-acuáticos, que contengan principalmente substratos templados y húmedos, ricos en materia orgánica (lines fuentes de agua contaminadas con estiércol, barro, praderas de agua, etc.) (6, 23). En general, las larvas se suelen encontrar en los primeros 5 o 6 cm de la capa superior del medio (22). Las crisálidas se encuentran también en la superfi cie del medio (barro o agua) donde tiene lugar el desarrollo de la larva (23). Los adultos se aparean en las inmediaciones de los cobertizos de ganado, principalmente cerca de medios húmedos o aguas estancadas. En efecto, rara vez se mueven lejos del sitio donde incuban (13). Los Culicoïdes spp. tienen un gran componente nocturno en su actividad. Durante el día, descansan en la sombra bajo hojas o hierbas (23). La supervivencia, la actividad y la dispersión de los Culicoïdes están muy infl uenciadas por factores metereológicos tales como la temperatura, la humedad y el viento. La temperatura es sin dudad el principal factor ambiental que afecta al comportamiento y la supervivencia de estos mosquitos. En efecto, su actividad alcanza su mayor nivel entre 13º C y 35º C (2), aunque estos límites varían de una especie a otra. Por ejemplo, Losson et al. (7) observaron vuelos de C. obsoletus a temperaturas mínimas entre 6º C y 12º C en cobertizos de ganado durante el verano 2006-2007. Un alto nivel de humedad es también un factor importante para el desarrollo y la supervivencia de los Culicoïdes (16). De hecho, las larvas son particularmente sensibles a la desecación, que las mata rápidamente. La sequedad es también desfavorable para los adultos y por eso se refugian en la vegetación hasta que un cambio en el tiempo les permita continuar con su actividad. También tienen aversión a la lluvia, porque no les permite volar. Estos comportamientos explican el hecho de que en áreas templadas estos vectores son particularmente abundantes hacia el fi nal del verano y el comienzo del otoño. 11 Durante el período de vuelo, los Culicoïdes adultos no se alejan más de unos cientos de metros del lugar donde emergieron los imagos. Su dispersión activa es, por tanto, muy limitada (13). Su dispersión pasiva por medio de vientos cálidos y húmedos que soplan a baja altura
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
16 LENGUA AZUL EN EL NORTE DE EUROPA DESDE MEDIADOS DE AGOSTO DE 2006 HASTA FINALES DE JULIO DE 2007 La lengua azul se identifi có por primera vez en el norte de Europa en Agosto de 2006 tras una ola de calor y lluvias fuertes. Puede decirse que es una enfermedad emergente en esta zona (20). Entre la primera notifi cación (17 de Agosto de 2006) y el 1 de Febrero de 2007 (8), 2.122 casos de LA se registraron en el Sistema de Notifi cación de Enfermedades Animales de la Comisión Europea (http://ec.europa.eu/food/animal/diseases/adns/ index_en.htm) (Fig. 3). En este área, en 2006, se encontró una reserva de 50 C. dewulfi (Goetghebuer) hembras y no ingurgitadas que dio positivo en el PCR para VLA en Holanda (14) y varias mezclas de complejo C. obsoletus (esto es, no identifi cado hasta el nivel de especie) que también dieron PCR positivo para VLA en Alemania (13) (Fig. 4). Aunque en ninguno de los dos casos se intentó el aislamiento del VLA vivo, este trabajo, llevado a cabo en un área donde el C. imicola no se da, confi rma las investigaciones de Mellor y Pitzolis (1979), quienes aislaron VLA infeccioso de C. obsoletus hembras y no ingurgitadas en Chipre y muestra que las especies autóctonas de Culicoïdes europeos pueden mantener una epizootia de LA (18). Dado que los mosquitos C. obsoletus y C. dewulfi se dan en Europa norte y central, toda esta área debe ser considerada de riesgo para el VLA (11, 25). El foco de interés debe estar ahora en ver si el VLA es capaz de sobrevivir en los períodos comprendidos entre las épocas de actividad de los vectores en el norte de Europa y así convertirse en endémico. La recrudescencia del VLA-8 en el norte de Francia, Holanda, Bélgica y Alemania en 2007, sugiere que puede darse el caso con bastante probabilidad (23). A diferencia de lo que ocurre en el sur, donde la población del vector tradicional C. imicola es mayor al fi nal del verano y durante el otoño, que es cuando ocurren la mayoría de los casos de LA, el pico de población de los vectores autóctonos ocurre en meses anteriores. Aún no se ha comprobado si esto se refl ejará en un cambio en la aparición temporal de los casos de LA. 17 Durante el período comprendido entre 2006 y el 10 de Agosto de 2007, nueve estados miembros de la UE informaron de brotes de LA que presentaban todos los serotipos registrados en Europa hasta 1998. (Fig. 5). Figura 3: Distribución mensual de brotes de LA (serotipo 8) confi rmados en Europa del norte y Europa central entre el 17 de Agosto 2006 y 1 de Febrero 2007 (1) Figura 4: Una hembra grávida de Culicoïdes dewulfi recogida en una zona cercana a los brotes de lengua azul en Bélgica 2006 (Fotografía: Reginald De Deken & Maxine Madre, Instituto de Medicina Tropical, Amberes, Bélgica) 18 Figura 5: Brotes de lengua azul en la Unión Europea en 2006 y 2007 (5, 6) Leyenda: BE, Bélgica, BG Bulgaria; DE, Alemania; ES, España; FR, Francia; IT, Italia; LU, Luxemburgo; NL, Holanda; PT Portugal. 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">ESPECIES SUSCEPTIBLES El virus de la lengua azul se transmite entre rumiantes hospedadores casi exclusivamente a través de las picaduras de las hembras de las especies vector de los mosquitos picadores Culicoïdes (17). La distribución global del VLA está, por tanto, restringida a aquellas regiones donde se dan estas especies de Culicoïdes y su período de transmisión se limita a la época en la que los vectores adultos están activos. Dependiendo de la especie, la actividad de los vectores adultos comienza en primavera. La actividad está positivamente correlacionada con la temperatura, alcanzando su máximo cuando la temperatura oscila entre 28ºC y 30ºC, decreciendo cuando las temperaturas bajan y, en el caso de vector Afro-Asiático C. imicola, dejando prácticamente de existir cuando las temperaturas son inferiores a 10ºC (17, 22). VLA puede infectar a un amplio espectro de rumiantes domésticos y salvajes. Sin 0 100 200 300 400 500 600 700 800 900 1.000 BE BG DE ES FR IT LU NL PT 2006 2007 (hasta el 10 de agosto) Número de brotes 19 embargo, sólo se han observado signos clínicos graves en algunas razas de ovejas (razas mejoradas) y algunas especies de ciervos (12, 24). El ganado bovino y caprino muestra normalmente infecciones subclínicas y, por tanto, puede convertirse en reservorio encubierto del virus para las ovejas (12).

 CAPACIDAD VECTORIAL Y COMPETENCIA DEL VECTOR El riesgo de la infección por VLA está estrechamente relacionado con la presencia del vector adulto Culicoïdes (17). Hasta hace poco tiempo, se creía que el C. imicola era el único vector importante de VLA en el sur de Europa, pero ahora se sabe que otras especies de vectores recientemente reconocidas también están implicadas, y puede ser que se identifi quen más en el futuro. La competencia del vector de una especie de insecto y la capacidad vectorial de la población del insecto son parámetros importantes (10). La competencia del vector es la habilidad (innata) del vector para adquirir un patógeno, mantenerlo y transmitirlo con éxito a un hospedador susceptible (22). La competencia del vector puede determinarse en un laboratorio, dándoles comidas de sangre que contengan una concentración de virus adecuada a grupos de insectos de una especie en concreto, y valorando los índices de contagio y transmisión. La competencia del vector se expresa tomando como base la proporción de insectos que han sido alimentados que repliquen el virus y lo puedan transmitir tras un período de incubación. En situaciones en las que resulta difícil demostrar la transmisión debido a problemas técnicos al realimentar a los insectos “difíciles” como el Culicoïdes, se ha establecido la práctica de asumir la capacidad de transmisión si es posible obtener el virus de las glándulas salivares del insecto. La capacidad vectorial se refi ere al potencial de transmisión que puede tener una población de insectos y tiene en cuenta un intervalo de variables medioambientales, de los insectos y de 20 los hospedadores incluyendo la abundancia de vectores, la supervivencia de vectores, la velocidad de transmisión, la tasa de picadura, las preferencias de los hospedadores y su abundancia en ciertas condiciones climáticas (ej. Bioclimáticas). La capacidad vectorial se puede defi nir como el número de picaduras infecciosas que un vector infectado hace durante su vida (esto es, entre dos y cuatro semanas en el caso del vector Culicoïdes) (10, 28). La determinación de los dos parámetros explicados anteriormente es esencial para permitir una estimación adecuada del ritmo de transmisión y así estar en posición de predecir si el VLA llegará a establecerse en un área. Tales estudios detallados requieren inevitablemente recursos económicos y científi cos importantes y requieren una aproximación multidisciplinar.

 MODOS DE INTRODUCCIÓN Y MECANISMOS DE AMPLIFICACIÓN La introducción del VLA de un área a otra puede ocurrir de cuatro maneras: a través de transportes animales (rumiantes salvajes y domésticos) o el transporte de productos animales (semen, embriones); por vector Culicoïdes infectado transportado por medios vivos (plantas, animales) o inanimados (barcos, aviones); a través del vuelo activo del vector Culicoïdes infectado (propagación local); y a través del vuelo pasivo (por el viento) del vector Culicoïdes infectado (responsable de la diseminación a larga distancia). El número y la distribución de los hospedadores susceptibles, la duración y título de viremia VLA en los hospedadores, la capacidad vectorial de la población de vector local y la temperatura del ambiente determinarán si el virus se establece en un nuevo área. En esencia, el establecimiento depende de que exista un número sufi ciente de vector Culicoïdes, infectado por alimentarse de hospedadores virémicos, que sobreviva lo sufi ciente para asegurar que se complete el período de incubación intrínseco (de 4 a 20 días, dependiendo de la temperatura ambiente) y que transmita el virus por 21 picadura a nuevos hospedadores (22). El período de incubación extrínseco es el intervalo entre el momento de infección de un vector y el momento en que es capaz de transmitir el VLA a un nuevo hospedador (15). Estos requisitos de establecimiento del VLA se han cumplido en gran parte del Sur de Europa, dado que el VLA ha sobrevivido allí en distintas zonas desde fi nales de los años 90. El recrudecimiento generalizado de las infecciones de VLA-8 en el norte de Francia y en Bélgica, Holanda, Luxemburgo y Alemania, y la extensión radial del VLA-8 en Europa en 2007 sugieren que, en época de cambio climático, los requisitos para el establecimiento del VLA pueden ahora cumplirse en muchas más partes del norte de Europa. Las autoridades veterinarias y los legisladores deberían tomar nota de esta situación.  24
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas=""> POLÍTICA DE PREVENCIÓN Y CONTROL DE LA LENGUA AZUL DE LA UNIÓN EUROPEA FRANCISCO REVERIEGO GORDEJO Comisión europea, Dirección General de Sanidad y Consumo, Bruselas, Bélgica ALBERTO LADDOMADA Comisión europea, Dirección General de Sanidad y Consumo, Bruselas, Bélgica BERNARD VAN GOETHEM Comisión europea, Dirección General de Sanidad y Consumo, Bruselas, Bélgica La política de la Unión Europea (UE) sobre la lengua azul (LA) ha evolucionado en los últimos diez años en paralelo con la dinámica de la enfermedad en el continente europeo. Hacia fi nales de los años 90, sólo se presentaron algunas epidemias de LA en la cuenca mediterránea tras un período en que la enfermedad no se había manifestado. La situación cambió de manera dramática cuando el VLA reapareció en Europa en 1998 y avanzó mas allá del paralelo 40, considerado hasta el momento el límite norte para la expansión de la enfermedad. Desde entonces la UE se ha visto obligada a afrontar esta nueva situación. La reacción de la UE ante esta nueva situación epidemiológica fue la Directiva 200/75/EC, basada en estándares de la OIE, que refl ejan parcialmente los aplicados a la peste equina. Este texto legislativo establece los límites principales de la política de la UE sobre la LA y presenta un grado sufi ciente de armonización y fl exibilidad para hacerlo adaptable a situaciones locales concretas. Las reglas de la UE con respecto a la LA establecen las medidas que los estados miembros deben tomar si se sospecha o confi rma un brote de LA. 4 25 Las medidas inmediatas se refi eren a la protección del ataque de vectores y las restricciones al transporte de los animales susceptibles. Las restricciones se aplican también a explotaciones situadas en un radio de 20 km alrededor de la explotación o explotaciones infectadas y, además, se deben establecer zonas de protección (radio de 100 km) y vigilancia (50 km más allá de los límites de la zona de protección y donde no se aplique vacunación) alrededor de las granjas infectadas. Estas restricciones no se levantan hasta que se haya erradicado el virus y la presencia de la enfermedad haya sido descartada. Dependiendo de las circunstancias epidemiológicas, geográfi cas, ecológicas y metereológicas, las autoridades competentes de los estados miembros pueden adaptar las medidas o tomar más, en particular en lo referente al transporte de animales fuera de las zonas restringidas y bajo ciertas condiciones establecidas en la legislación vigente. Una gran parte del territorio de la UE está situado dentro de las áreas tradicionales de distribución del virus (aproximadamente entre latitudes de 50ºN y 35º S), y por eso la UE ha podido adquirir un alto nivel de conocimiento técnico y experiencia en LA durante la década pasada. Sin embargo, la situación epidemiológica local de la LA está cambiando y se sabe que la LA se está extendiendo hacia el hemisferio norte y la UE ha experimentado incursiones recientes de diferentes serotipos de virus LA. Para adaptarse a estos nuevos retos, la política de la UE ha estado evolucionando y propone de aqui en adelante un conjunto de normas basadas en datos científi cos, viables, proporcionadas y racionales con el fi n de controlar la enfermedad, minimizar su impacto negativo y erradicarla en ciertas circunstancias. La política de la UE se basa en tres pilares: vigilancia e intercambio claro de información epidemiológica, restricciones proporcionadas en transportes y vacunación. 26 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">MONITOREO Y VIGILANCIA DE LA LENGUA AZUL EN LA UNIÓN EUROPEA Para obtener un mejor entendimiento de la situación epidemiológica y de los riesgos asociados a la LA, y para establecer medidas proporcionadas, es necesario establecer programas de monitoreo y vigilancia adaptados a los riesgos. Los programas de monitoreo de lengua azul se implementan en zonas restringidas y tienen como objetivo proporcionar información sobre la dinámica de la LA en una zona que ya esté sujeta a restricciones. Estos programas incluyen al menos un programa de monitoreo serológica, que consiste en un programa anual de prueba de animales centinela que pretende evaluar la circulación del virus LA dentro de las zonas restringidas, y un programa de monitoreo entomológica, que consiste en un programa activo de caza de vectores utilizando trampas para determinar la dinámica de la población y las características de hibernación del vector (especie Culicoïdes) para determinar la estación libre de vectores. Los programas de vigilancia de lengua azul se implementan fuera de las zonas restringidas y tienen como objetivo la detección precoz de la circulación del virus en zonas o estados miembros libres de LA. Estos programas de control incluyen vigilancia clínica pasiva para detectar e investigar indicios de LA mediante un sistema de aviso temprano para registrar posibles casos; control serológico basado en pruebas serológicas aleatorias o seleccionadas en poblaciones de especies susceptibles para detectar la transmisión del virus LA, y control entomológico que consiste en la captura de vectores para recopilar información de las especies reconocidas y potenciales, su distribución y sus perfi les estacionales. 27 Además, se ha establecido un sistema de información llamado LA-Net para recopilar e intercambiar datos sobre el control de LA en la UE y en muchos otros países vecinos. Este sistema es una herramienta de gestión de la enfermedad útil que asegura el intercambio rápido de información sobre la situación de la enfermedad y los datos de control entre los estados miembros. Es una herramienta esencial para modular las medidas de control de la enfermedad y facilitar el comercio seguro de rumiantes vivos, reduciendo así las pérdidas causadas por la enfermedad.

TRANSPORTE DE ANIMALES DENTRO DE LAS ZONAS RESTRINGIDAS Y DESDE LAS MISMAS Los desplazamientos de animales dentro de la misma zona restringida (donde está circulando el mismo serotipo del virus LA) no están restringidos. Sin embargo, los animales en zonas restringidas sólo pueden desplazarse a zonas libres de LA si cumplen ciertos requisitos bien defi nidos. Básicamente, los animales que han estado protegidos de ataques de vectores durante 60 días o que se encuentren en una zona estacionalmente libre se consideran seguros. También, los animales que han sido protegidos de ataques de vectores durante entre 14 y 28 días y dan negativo en resultados de pruebas PCR o ELISA se consideran libre. Además, los animales vacunados o naturalmente inmunizados se consideran seguros y, por tanto, se les permite moverse a zonas libres de LA.

28 VACUNACIÓN CONTRA LA LENGUA AZUL La vacunación es la medida más efectiva que puede implantarse en un territorio infectado para reducir el impacto de la enfermedad. El objetivo principal de la vacunación es evitar casos clínicos y, por tanto, limitar las pérdidas de los ganaderos. La vacunación se utiliza también para controlar la enfermedad, puede usarse para facilitar el comercio seguro o incluso para erradicar la enfermedad. Sin embargo, la vacunación presenta ciertos inconvenientes. Existen vacunas vivas atenuadas (clásicas) para la mayoría de los serotipos. Son baratas, protegen tras una sola inoculación y previenen la enfermedad clínica. Sin embargo, se han descrito algunos efectos adversos (por ejemplo abortos provocados por vacunas no sufi cientemente atenuadas). Además, se propaga por vectores de la misma manera que el virus salvaje, y existe la posibilidad de reversión a la virulencia y redistribución de genes con aquellos virus salvajes de las cepas del campo. Las vacunas a virus inactivados son seguras y pueden ser efectivas, pero son más caras y es necesaria la re-vacunación. La disponibilidad de estas vacunas se limita a varios serotipos, pero es factible producir vacunas para nuevos serotipos en grandes cantidades. La UE ha apoyado la opción de la vacunación en los casos en que las autoridades nacionales han decidido adoptar tal política, y considera que las ventajas de la vacunación se maximizan cuando los estados miembros afectados adoptan una estrategia armonizada. Resumiendo, la política de la UE en materia de LA es sostenible, proporcionada, basada en la ciencia y lo sufi cientemente fl exible para adaptarse al cambio climático global, a la vez que respeta el principio subyacente de que las decisiones deben minimizar el impacto en la economía y deben ser entendidas y apoyadas por los diversos agentes para ser totalmente efectivas. 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">29 ROL DE LA ORGANICACIÓN MUNDIAL DE SANIDAD ANIMAL GIDEON BRÜCKNER Organización Mundial de Sanidad Animal, París, Francia JEAN-LUC ANGOT Organización Mundial de Sanidad Animal, París, Francia INTRODUCCIÓN Uno de los objetivos primordiales de la Organización Mundial de Sanidad Animal (OIE) es prevenir la propagación de las enfermedades a través del comercio internacional de animales y de los productos de los mismos. Esto se consigue estableciendo estándares internacionales para un amplio espectro de enfermedades. Los estándares de la OIE relacionados con la lengua azul (LA) se publican en el Código Sanitario para los Animales Terrestres (Código Terrestre) y el Manual de Pruebas de Diagnóstico y Vacunas para los Animales Terrestres (Manual Terrestre). Estos estándares incluyen directrices y recomendaciones para declarar un país o una zona libre del virus LA (VLA), requisitos para la libertad estacional de VLA y recomendaciones para la importación segura de animales vivos, semen y embriones a un país o zona libre de VLA, así como directrices de vigilancia para LA. En el Código Terrestre y el Manual Terrestre se encuentran también otros capítulos generales, pero relacionados con la LA, que complementan al Capítulo 2.2.13 (www.oie.int/eng/normes/mcode/en_chapitre_2.2.13.htm) y al apéndice 3.8.10 (www.oie.int/eng/normes/mcode/en_chapitre_3.8.10.htm) específi co sobre LA. 5 30 El desarrollo de estándares sobre la LA que permitan el comercio seguro de animales y productos animales ha sido muy difícil dado que gran parte del mundo entre las latitudes de aproximadamente 53ºN y 35ºS está ya infectado o tiene el potencial para ser infectado (4). Esta tarea se complica aún más por la presencia de 24 serotipos de VLA y muchos vectores reconocidos y potenciales con distintos grados de competencia. ESTÁNDARES DEL CÓDIGO SANITATIO PARA LOS ANIMALES TERRESTRES DE LA OIE PARA LA LENGUA AZUL El Código Terrestre (2) considera que el período inefectivo del virus de la lengua azul (VLA) es de 60 días y que la distribución global del VLA está actualmente entre las latitudes de aproximadamente 53ºN y 35ºS, aunque se sabe que la enfermedad se está extendiendo en el hemisferio norte. En ausencia de la enfermedad clínica en un país o una zona dentro de estas latitudes, el estatus de VLA debe determinarse mediante un programa de vigilancia continua (2). Puede que el programa tenga que adaptarse a las zonas del país con mayor riesgo debido a factores históricos, climáticos y geográfi cos, datos de población de rumiantes y ecología de Culicoïdes, o proximidad a zonas enzoóticas o de incursión. Todos los países o zonas adyacentes a un país o a una zona que no tenga un estatus libre deberían estar sujetos a una vigilancia similar. En tales casos, la vigilancia debería en general llevarse a cabo en un radio de al menos 100 km. de la frontera con ese país o con esa zona. El capítulo sobre LA en el Código Terrestre (Capítulo 2.2.13) estipula la aplicación de una zona estacionalmente libre de VLA comenzando el día después de la última evidencia de transmisión de VLA y con el cese de la actividad de vector Culicoïdes posiblemente competente. Se considera que el periodo estacionalmente libre termina al menos 28 días antes de la 31 fecha de reinicio de la circulación del VLA, el periodo más precoz conocido historicamente. El capítulo sobre LA estipula varios procedimientos para el transporte de rumiantes y otros herbívoros susceptibles de LA, basados en la epidemiología de la LA y el período que los animales deben pasar en la zona o país libre de LA antes del traslado: si el período es de 60 días o más, no hay restricciones; si el período es de al menos 28 días, se requiere un test serológico negativo para la presencia de anticuerpos; si el período es de al menos 7 días se requiere un test negativo para la identifi cación de agentes. El Código Terrestre estipula que los animales deben vacunarse al menos 60 días antes del transporte o presentar una certifi cación de que no han transitado por zonas infectadas o de que han sido protegidos de vectores Culicoïdes competentes. Los requisitos para la importación desde zonas estacionalmente libres de LA son prácticamente los mismos. Los requisitos para importar animales susceptibles de países o zonas infectadas por LA son muy parecidos para los períodos de observación de 60, 28 o 14 días antes del traslado, con el requisito adicional de protección del ataque de posibles vectores Culicoïdes competentes. Pueden ser requisitos alternativos que los animales estén vacunados al menos 60 días antes del traslado o que se haya realizado vigilancia en un periodo similar de acuerdo con el Apéndice 3.8.10. del Código Terrestre. También se describen los requisitos acerca de la importación de semen, embriones y óvulos de animales susceptibles de LA y se basan en los mismos procedimientos dependiendo del estatus del país o zona de origen.

32 DIRECTRICES ESPECÍFICAS DE VIGILANCIA PARA LENGUA AZUL El apéndice 3.8.10 del Código Terrestre establece directrices específi cas de vigilancia de LA, aunque se sabe que el impacto y la epidemiología de la LA difi ere ampliamente en las distintas regiones del mundo y es por tanto imposible establecer líneas de vigilancia para todas las situaciones. Los estados y territorios miembros de la OIE deberían aportar, por tanto, datos científi cos que expliquen la epidemiología de la LA en la región y adaptar las estrategias de vigilancia a las condiciones locales para defi nir el status de la infección (zona/país libre, estacionalmente libre o infectado). El Apéndice establece una defi nición de caso de infección por LA; describe las condiciones generales y los métodos de vigilancia, distintas estrategias de vigilancia para control clínico, serológico, virológico y de vectores e información sobre como interpretar las pruebas de detección del virus.

PROVISIONES GENERALES DEL CÓDIGO TERRESTRE RELEVANTES A LA LENGUA AZUL Además del capítulo específi co acerca de la Lengua azul, el Código Terrestre también describe los criterios para la notifi cación de la enfermedad, directrices para que los Servicios Veterinarios evalúen la credibilidad de la certifi cación, aspectos relacionados con las obligaciones y la ética en el comercio internacional, los principios de zonifi cación y directrices para llevar a cabo análisis de riesgo en la importación. Estos capítulos y apéndices deberían consultarse conjuntamente con el capítulo y el apéndice específi cos sobre la enfermedad a la hora de evaluar los riesgos para la importación y las medidas de control y mitigación de la enfermedad.

EL MANUAL DE PRUEBAS DIAGNÓSTICAS Y VACUNAS PARA LOS ANIMALES TERRESTRES DE LA OIE El Manual Terrestre (3) es un volumen que acompaña al Código Terrestre y proporciona una aproximación uniforme al diagnóstico de la LA. El objetivo es facilitar el comercio internacional de animales y productos animales mediante la descripción de las prácticas de laboratorio acordadas para el diagnóstico y los requisitos para la producción y el control de vacunas para LA. Las prácticas descritas también conforman la base para una vigilancia y monitoreo efectivos. CONCLUSIÓN Mediante el establecimiento de estándares internacionales de comercio seguro para prevenir la propagación de la LA, la OIE no sólo cumple con su mandato internacional y sus obligaciones, como reconoce la Organización Mundial de Comercio (3), sino que también facilita las negociaciones comerciales proporcionando una referencia científi ca para asegurar la continuidad del comercio sin restricciones innecesarias e injustifi cadas.

INTRODUCCIÓN El virus de la lengua azul (VLA) es capaz de infectar a una amplia variedad de rumiantes domésticos y salvajes. Sin embargo, sólo algunas razas ovinas y algunas especies de la familia de los Cervidos presentan un cuadro clínico grave: el ganado bovino y las cabras sufren una infección subclínica y representan un reservorio del virus (6, 11). Los signos clínicos referidos habitualmente incluyen fi ebre, salivación, descarga nasal, edema (especialmente de la cabeza), congestión y ulceración de la mucosa oral, debilidad, depresión y a veces cianosis de la lengua (de ahí el nombre lengua azul) (4, 6, 10, 12). Las tasas de morbilidad y mortalidad y la tasa de letalidad (relacionada con la gravedad de las signos clínicos), dependen de varios factores, tales como 6 35 la raza y la edad de los animales infectados (los animales más viejos son más susceptibles) y el serotipo y la cepa implicados (7). El diagnóstico presuntivo de lengua azul (LA) depende de la pericia de los veterinarios y ganaderos para reconocer los principales signos de alerta. Los veterinarios deben estar por tanto bien informados y deben aplicar procedimientos estándar de examen clínico. La identifi cación de casos sospechosos de LA es determinante en el marco de la detección precoz de una enfermedad y de su notifi cación a las autoridades competentes. Entre otras ventajas, la notifi cación permite a las autoridades determinar las zonas de actividad de los vectores, consiguiendo así una mejor comprensión de la epidemiología de la enfermedad para poder implementar las medidas de control más efi caces. El objetivo principal de este capítulo es describir casos de LA (serotipo 8) ocurridos durante la epizootia que tuvo lugar en el norte de Europa el verano de 2006 y durante el resurgimiento de la enfermedad en el verano de 2007 (8, 9). Los datos expuestos en este capítulo se recogieron de manera estandarizada por un equipo multidisciplinar de la Facultad de Medicina Veterinaria de la Universidad de Lieja (3). Durante el brote en Europa, la LA (VLA-8) infectó principalmente a ganado ovino y bovino, con una incidencia similar en ambas especies (1, 2). Durante la reaparición de la LA en verano de 2007, la tasa de incidencia en ganado ovino fue ligeramente mayor que en ganado bovino. Unos meses más tarde, sin embargo, la tasa de infección del ganado bovino se igualó a la del ganado ovino. Se comunicaron pocos casos en ganado caprino, aunque esta especie también es susceptible a la enfermedad (5). Los datos clínicos descritos a continuación se refi eren a ganado ovino y bovino de manadas donde la LA fue confi rmada por pruebas de laboratorio (13). 36 Se ha incluido la descripción clínica de la LA en yaks para dirigir la atención de los veterinarios y los ganaderos al hecho de que existen otras especies de rumiantes que también pueden ser afectadas. Para mayor legibilidad, se han agrupado los signos clínicos topográfi camente para cada una de las especies. Esto contrasta con el Capítulo 11, donde los signos clínicos se agrupan según el sistema de órganos implicados. Se han agrupado en distintas categorías: signos clínicos generales, locales (cabeza, extremidades, ubres, piel, pelo, lana) y reproductivos. En el Cuadro III se presenta un resumen de signos clínicos observados en ganado bovino y ovino en 2006 y 2007. El Cuadro III también indica la presencia o ausencia de estos signos en dos yaks (Bos grunniens grunniens) en 2006. Las tasas de morbilidad, mortalidad y letalidad observadas en ganado ovino y bovino durante la epizootia de LA se muestran en el Cuadro

37 SIGNOS CLÍNICOS GENERALES Raras veces se observó hipertermia (sólo en 5 de los 38 bovinos estudiados). Sin embargo, la hipertermia puede ser leve y transitoria y por tanto pasar inadvertida. De aquí, que este signo clínico no sea representativa en absoluto y no se considere un dato fi able. La mitad de los ganaderos mencionaron una reducción en la producción de leche. Sin embargo, este signo clínico sólo se debería considerar defi nitivamente presente basándose en parámetros objetivos, como registros de producción de leche. Se sabe que existen numerosos factores que infl uyen en la producción de leche en las vacas lecheras (por ejemplo, la estación, el número de lactaciones, el estado de la lactación, la temperatura ambiente, la nutrición, la disponibilidad y temperatura del agua que beben). Según los ganaderos, este signo parecía persistir bastante tiempo (varias semanas) tras la desaparición de otros signos clínicos. Rara vez se detectó anorexia, aunque sí pérdida de peso. La pérdida de peso podría haberse debido a la pérdida del apetito durante el periodo febril o a lesiones orales que difi cultaran la ingesta de comida. La pérdida de peso y/o la reducción en la ingestión de alimentos no se midieron con precisión. Eran observaciones hechas por los ganaderos y referidas por lo veterinarios. Finalmente, los animales afectados por la LA presentaban abatimiento.

SIGNOS CLÍNICOS LOCALES: CABEZA Las lesiones más precoces, las más frecuentes y las más persistentes estaban localizadas en el morro y las fosas nasales. La zona dorsal del morro hasta la unión mucocutánea, estaba cubierta de lesiones ulcerosas a necróticas. Estas lesiones aparecían generalmente en las partes no pigmentadas (Foto 1) pero a 38 veces cubrían todo el morro (Foto 2). Lesiones parecidas podían observarse a menudo también en el ala externa de los orifi cios nasales (Foto 3). Estas lesiones generalmente formaban costras. Algunos animales presentaban descarga nasal, que podía ser mucopurulenta o seromucosa. Poco después de que apareciesen las primeras lesiones en el morro, se encontraron lesiones en la cavidad oral. Las ulceraciones eran comunes. La mayoría de estas lesiones se situaban alrededor de los dientes en los lados linguales de las encías, y se podían extender hasta 1cm desde los dientes (Fotos 4 y 5). A veces la ulceración aparecía en la almohadilla dentaria (Foto 5) y en la mucosa de los carrillos de la vaca. La cianosis de la lengua (esto es, la lengua azul) se detectó en muy pocos casos. En algunos casos se observó hipersalivación y regurgitación. La dermatitis periocular aparecía también de manera habitual (Foto 6). Podía estar acompañada de costras y epífora y se daba en las primeras etapas de la enfermedad. Finalmente, se observó un edema submandibular en uno de los animales (Foto 7). Esta era una muestra clínica rara en los bovinos afectados por LA.

SIGNOS CLÍNICOS LOCALES: EXTREMIDADES En las primeras etapas de la enfermedad se notó una infl amación de las partes inferiores de las extremidades. La infl amación afectaba al espolón y la cuartilla pero rara vez se extendía más allá de la caña (Foto 8). Los animales afectados por la lengua azul parecían dudar al andar y mostraban rigidez muscular, cojera o incluso reticencia a moverse. En los casos más graves, los animales no podían levantarse y las consecuencias eran en general mortales. 39 FOTO 1: Lesiones ulcerosas y necróticas moderadas alrededor del morro (ganado bovino Facultad de Medicina Veterinaria, Universidad de Lieja FOTO 2: Lesiones necróticas y ulcerosas graves extendidas por todo el morro; descarga nasal de seromucosa (ganado bovino) Facultad de Medicina Veterinaria, Universidad de Lieja FOTO 3: Lesiones necróticas y ulcerosas alrededor de las fosas nasales (ala exterior de la nariz); descarga mucosa purulenta (ganado bovino) Facultad de Medicina Veterinaria, Universidad de Lieja FOTO 4: Ulceraciones gingivales de 1cm detrás de los incisivos (ganado bovino) Facultad de Medicina Veterinaria, Universidad de Lieja FOTO 5: Úlceras en las encías y en la almohadilla de los incisivos (ganado bovino) Facultad de Medicina Veterinaria, Universidad de Lieja FOTO 6: Dermatitis periocular (ganado bovino) Facultad de Medicina Veterinaria, Universidad de Lieja FOTO 7: Edema submandibular (ganado bovino) Facultad de Medicina Veterinaria, Universidad de Lieja FOTO 8: Edema de cuartilla y espolón Facultad de Medicina Veterinaria, Universidad de Lieja 40 SIGNOS CLÍNICOS LOCALES: UBRES Con bastante frecuencia, y en general después de la nueva aparición de lesiones en la cabeza, se observó eritema de las ubres (Foto 9). Con más frecuencia aún, aparecían lesiones necróticas y ulcerosas en los pezones (Foto 10). Estas lesiones causaban difi cultades al ordeñar, estaban asociadas con una disminución en la ingesta de alimento y podían haber sido la causa de la reducción en la producción de leche. El impacto de la LA en el contenido de células somáticas de la leche y la incidencia de mastitis no fueron evaluados. 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">SIGNOS CLÍNICOS LOCALES: PIEL Y PELO Se observaron lesiones necróticas en la piel no pigmentada del lomo y en el área próxima a la raíz del rabo pero estas últimas se daban sólo entre dos y tres semanas después de la aparición de los primeros signos clínicos. En algunos casos estas lesiones (necrosis seca) derivaban en el desprendimiento de jirones de piel (Foto 11). Estas lesiones eran parecidas en apariencia a aquellas inducidas por la fotosensibilización, pero se daban en animales que habían estado bajo techo y, por lo tanto, lejos de la luz del sol directa.

SIGNOS CLÍNICOS REPRODUCTIVOS En 2007, se detectaron en el campo varias sospechas de aborto, metritis y anormalidades congénitas relacionadas con la LA. Sin embargo, el episodio de LA tuvo lugar tarde en la época de cría y nuestros descubrimientos podrían haber sido tendenciosos. 41 FOTO 9: Eritema de pezones y ubre (ganado bovino) Facultad de Medicina Veterinaria, Lieja FOTO 10: Lesiones ulcerosas y necróticas de los pezones (ganado bovino) Facultad de Medicina Veterinaria, Lieja FOTO 11: Lesiones necróticas secas que derivan en el desprendimiento de jirones de piel (ganado bovino) Facultad de Medicina Veterinaria, Lieja FOTO 12: Lesiones ulcerosas necróticas de los labios, orifi cios nasales y morro (ganado ovino) Facultad de Medicina Veterinaria, Lieja FOTO 13: Lesiones ulcerosas en la boca (ganado ovino) Centro de Mouton, Universidad de Namur FOTO 14: Hipersalivación y edema de cara (ganado ovino) Centro de Mouton, Universidad de Namur FOTO 15: Regurgitación (ganado ovino) Centro de Mouton, Universidad de Namur FOTO 16: Cianosis de la lengua (ganado ovino) Centro de Mouton, Universidad de Namur 42

EVOLUCIÓN E IMPORTANCIA DE LOS SIGNOS CLÍNICOS En la gran mayoría de los casos, el ganado bovino sobrevivió a la enfermedad y sus lesiones remitieron signifi cativamente dentro de un plazo de entre 4 y 8 semanas. El rendimiento reproductivo pareció ser lo que tardó más en volver a la normalidad. En algunos casos raros, los animales permanecieron tumbados y su condición se deterioró hasta que murieron. Aunque parece que no existe ningun segno clínico patognomónica para LA, el cuadro clínico dominante consiste en lesiones ulcerosas y necróticas en el morro, en las fosas nasales y en la cavidad oral, y cojera y lesiones en los pezones en el animal adulto. SIGNOS CLÍNICOS EN GANADO OVINO El período de incubación en ovejas dura entre 6 y 8 días (intervalo: 2-18 días). Las lesiones en ovejas son más edematosas y hemorrágicas que en ganado bovino. La siguiente descripción de signos clínicos se basa en observaciones realizadas en 39 ovejas y un cordero de cuatro rebaños principalmente de raza Texel situados en las provincias de Lieja y Namur, en Bélgica. Se realizó un seguimiento clínico semanal de algunos de estos animales.

SIGNOS CLÍNICOS GENERALES A diferencia de lo que ocurría con el ganado bovino, en ganado ovino se observó hipertermia transitoria (hasta 42ºC) de manera frecuente. La apatía y la anorexia (no ingesta de comida o agua en los animales más gravemente 43 afectados) y la consiguiente considerable pérdida de peso fueron también más frecuentes que en el ganado bovino. Se observó diarrea en algunas ocasiones, fundamentalmente cuando los animales recuperaban su comportamiento alimentario durante la etapa de recuperación. En ovejas lecheras, se observó en algunos casos una disminución en la producción de leche e incluso agalactia.

SIGNOS CLÍNICOS LOCALES: CABEZA En general, los signos clínicos observados en ovejas eran similares a los observados en ganado bovino, a saber, lesiones ulcerosas y necróticas en labios, orifi cios nasales y morro (Foto 12), úlceras en la cavidad oral (Foto 13) e hipersalivación (Foto 14). La regurgitación se daba de manera más frecuente en ovejas que en ganado bovino (Foto 15). A diferencia del ganado bovino, la cianosis de la lengua se observó en varias ocasiones en las ovejas (Foto 16). Se observó edema de la zona periocular (Foto 17) y/o de la cara (Foto 18) también con más frecuencia que en el ganado bovino; el edema sublingual, sin embargo, fue menos frecuente (Foto 19). Se observó también dermatitis periocular en las ovejas.

SIGNOS CLÍNICOS LOCALES: EXTREMIDADES Se observaron habitualmente cojera, edema en las extremidades, congestión de las bandas coronarias así como rigidez en las extremidades junto con amiotrofi a. Estos signos fueron más frecuentes y graves que en ganado bovino. 44 FOTO 17: Edema periocular (signo clínico temprano) (oveja) Centro de las ovejas, Universidad de Namur FOTO 18: Edema de cara en un cordero; descarga nasal mucosa y purulenta Centro de las ovejas, Universidad de Namur FOTO 19: Edema subglosal (oveja) Centro de las ovejas, Universidad de Namur FOTO 20: Eritema de la piel de la ubre (oveja) Facultad de Medicina Veterinaria, Universidad de Lieja FOTO 21: Hipersalivación, cianosis grave de la lengua (Yak: Bos grunniens grunniens) Facultad de Medicina Veterinaria, Universidad de Lieja FOTO 22: Úlceras de las mucosas lingual, palatal y gingival (principalmente detrás de los incisivos) (Yak: Bos grunniens grunnniens) Facultad de Medicina Veterinaria, Universidad de Lieja 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">45 SIGNOS CLÍNICOS LOCALES: UBRES Al igual que ocurría con el ganado bovino, se observó eritema de la piel de la ubre junto con lesiones ulcerosas en los pezones (Foto 20). Este signo fue detectado con menos frecuencia en ovejas no lecheras, probablemente por falta de observación (cría extensiva y lana que escondía las lesiones). 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">SIGNOS CLÍNICOS LOCALES: PIEL Y LANA A veces se daba una pérdida localizada de lana, acompañada de dermatitis (costras). Estas lesiones no son fáciles de identifi car en ovejas no esquiladas. Lesiones similares a las de fotosensibilización, como las encontradas en el lomo de algunas reses de ganado bovino no se han descrito en ovejas. Sin embargo, algunas lesiones de este tipo aparecieron en las orejas de algunas ovejas. Se observó una pérdida de lana durante el período de recuperación, posiblemente como consecuencia de la hipertermia. 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">SIGNOS CLÍNICOS REPRODUCTIVOS A día de hoy es imposible decir si los abortos observados durante el brote del epizoótico de la LA los causó la enfermedad. En aquellos carneros en los que se evaluó la calidad del semen entre cuatro y seis semanas después del comienzo de los signos clínicos, se observaron modifi caciones micro y macroscópicas (semen aguado con ausencia de espermatozoides vivos). 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">EVOLUCIÓN E IMPORTANCIA DE LOS SIGNOS CLÍNICOS En general, los signos clínicos observados en ganado ovino son más debilitantes que los observados en ganado bovino. Otras patologías (neumonía, diarrea, eritema contagioso y otras enfermedades intercurrentes como la infección por parásitos y uñeros) complicaron el cuadro clínico de la LA. En los casos en los que la enfermedad fue fatal, el intervalo entre las primeras signos clínicos y la muerte fue de entre 8 a 12 días. Este intervalo puede ser más breve en razas mejoradas (de 1 a 4 días). Estos animales murieron a menudo por complicaciones (por ejemplo del tracto respiratorio). Los animales que sobrevivieron tuvieron un largo período de recuperación (que empezó dos semanas después del comienzo de la enfermedad). Se observaron secuelas después de la recuperación: crecimiento reducido (demora en el crecimiento), peor calidad de la carne y la lana e infertilidad en el caso de los carneros. Formas subagudas de lengua azul se observan con muy poca frecuencia en Europa. Los signos predominantes en las ovejas son las lesiones ulcerosas y necróticas del morro, las fosas nasales y/o la cavidad oral, la pérdida de peso y la cojera. SIGNOS CLÍNICOS EN OTROS RUMIANTES: EJEMPLO DEL YAK (BOS GRUNNIENS GRUNNIENS) Dos yaks hembra viviendo en cautividad en un campo de cría fueron examinadas clínicamente y post mortem. La lengua azul se confi rmó en estos animales tomando como base los análisis de laboratorio. 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">SIGNOS CLÍNICOS GENERALES Ambos animales presentaban el lomo arqueado y letargia. Se percibió pérdida de peso y reducción en la producción de leche en uno de los animales, que estaba lactando. SIGNOS CLÍNICOS LOCALES: CABEZA Al igual que en el ganado bovino, los signos clínicos más comunes en los yaks estaban situadas en la zona de los ojos, los orifi cios nasales y la cavidad oral. Ambos animales presentaban conjuntivitis, eritema periocular y epifora. Existían lesiones ulcerosas y necróticas leves visibles alrededor de los orifi cios nasales. En una de las dos hembras se diagnosticó hipersalivación, cianosis prinunciada y edema sublingual (Foto 21). Se encontraron numerosas úlceras en la mucosa lingual, el paladar y las encías, principalmente caudal a los incisivos (Foto 22). SIGNOS CLÍNICOS LOCALES: EXTREMIDADES Ambos animales eran reacios a moverse y estaban normalmente tumbados. La postura arqueada del lomo puede que indicase una lesión del sistema locomotor, aunque no hubo evidencia de miositis en el examen post mortem. Presentaban un leve edema de las extremidades visible alrededor de la cuartilla. 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">SIGNOS CLÍNICOS LOCALES: UBRES En la ubre de unos de los animales se observó dermatitis con pápulas y costras. 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">SIGNOS CLÍNICOS LOCALES: PIEL Y PELO Uno de los dos animales presentaba dermatitis aguda localizada en los muslos interiores. 
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">PROGRESIÓN E IMPORTANCIA DE LOS SIGNOS CLÍNICOS La progresión de los signos clínicos y el deterioro de los animales fueron muy rápidos, conduciendo a la muerte siete días después de la reducción en la ingesta de comida. En líneas generales, los signos clínicos fueron muy pronunciados en ambos animales. Esto se debe, probablemente, a su mal estado y a la difi cultad de administrar tratamiento de apoyo. Cuadro III: Signos clínicos de la lengua azul (virus serotipo 8) en ganado bovino y ovino y en yaks viviendo en cautiverio, examinados por la Facultad de Medicina Veterinaria de la universidad de Lieja durante el brote en el Norte de Europa en 2006 y el resurgimiento de la enfermedad en 2007 50 Parametro Ovino Bovino Tasa de morbilidad Media 20% 6.8% Minimo – maximo 0% – 100% 0% – 100% Otros ≤ 25% en 80% de las explotaciones ≤ 10% in 87% de las explotaciones Tasa de mortalidad Media 5% 0.3% Minimo – maximo 0% – 100% 0% – 30% Otros ≤ 20% en 93% de las explotaciones ≤ 5% en 99% de las explotaciones Tasa de letalidad Minimo – maximo 0% – 100% 0% – 100% Otros 50% en 23% de las explotaciones 50% en 6% de las explotaciones * Leyenda : En 2007, estas tasas fueron mayores que en 2006 (2 a 3 veces) CONCLUSIONES El brote de BT (serotipo 8) que se dio en el norte de Europa durante el verano de 2006 fue una sorpresa para veterinarios y ganaderos porque esta enfermedad vectorial era inesperada en estas regiones y porque la enfermedad se dio tanto en ganado ovino como bovino. Los signos clínicos observados eran parecidos a los descritos en la literatura, exceptuando que la cianosis de la lengua se observó en muy pocos casos. Las lesiones ulcerosas y necróticas en el morro y las fosas nasales y en la cavidad oral, las lesiones ulcerosas en las ubres y pezones, las lesiones similares a las de fotosensibilidad, la cojera y el deterioro de la condición corporal son Cuadro IV: Mortalidad, morbilidad y tasa de letalidad observadas en ganado ovino y bovino durante el epizoótico de lengua azul (virus serotipo 8) en el Norte de Europa en el verano/otoño 2006 51 algunos de los signos que alertan de LA en la región donde la enfermedad es endémica. Los signos clínicos mencionados anteriormente deben ser monitorizados de manera estandarizada (véase Capítulo 11), tan pronto como las condiciones climáticas permitan que el vector esté activo. Dada la diversidad de los signos clínicos y el hecho de que ninguno de ellos es patognomónico para LA, deben realizarse pruebas de laboratorio para confi rmar el diagnóstico (véase Capítulo 8 para diagnóstico diferencial). El profesional debe alertar al inspector veterinario en caso de sospecha de LA (la LA es una enfermedad de declaración obligatoria) y programar análisis de laboratorio para confi rmar o descartar la sospecha clínica (véase Capítulo 9 para análisis de laboratorio). Las muestras pertinentes deberán ser enviadas a un laboratorio de referencia.
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas=""> LENGUA AZUL: LESIONES GRAVES DOMINIQUE CASSART Facultad de Medicina Veterinaria, Universidad de Lieja, Bélgica KRIS DE CLERQ Centro de Investigación Veterinaria y Agroquímica, Bruselas, Bélgica Toda la patología de la lengua azul está relacionada con daños vasculares endoteliales, que resultan en un aumento de permeabilidad y fragilidad capilares, coagulación intravascular diseminada y, en último término, necrosis del tejido. Las lesiones macroscópicas más comunamente observadas son edemas, congestión, hemorragias, infartos e infl amación (2).
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas="">
<2 .000="" 10="" 14="" 16.="" 1956="" 1960="" 1998-2005="" 1998.="" 1998="" 1="" 2005="" 3="" 40="" 4="" 9="" a="" abril="" adem="" adultos="" afectadas="" afro-asi="" aisl="" al="" algunas="" algunos="" amberes="" amplia="" amplifi="" an="" animal="" animales="" anteriores="" antes="" aparecen="" aparici="" atribuido="" aut="" azul:="" azul="" b="" balcanes="" berkvens="" breve="" brote="" c.="" caci="" cado="" cambio="" cap="" capacidad="" casos="" causante="" central="" cepas="" cientos="" cinco="" claude="" clim="" comercio="" como="" competencia="" complejos="" con="" confi="" consideraba="" considerable="" contaba="" continuada="" cortos.="" crucial="" ctona="" cuando="" cuenca="" culico="" daba="" de="" declaraci="" dedujo="" del="" densidad="" dentro="" dependiendo="" des="" desaparecen="" desarrollan="" descripci="" desde="" despierta="" dicos="" dirk="" discusi="" dispersi="" distancia="" distribuci="" donde="" dos="" durante="" eigen="" ejemplo="" el="" ello="" en="" encuentran="" enfermedad="" entre="" epidemiol="" epidemiolog="" epizo="" era="" es="" espa="" especie="" especies="" espor="" esquema="" est="" esta="" estaci="" estado="" estados="" estanques="" este="" esto="" europa="" europea="" ex="" expansi="" explicar="" factor="" facultad="" fi="" fig.1="" forma="" generaciones="" general="" gica="" gico="" gicos.="" h="" ha="" hab="" han="" hasta="" hecho="" identifi="" ieffer="" ii="" imicola.="" imicola="" implicaci="" importante="" impunctatus="" inclu="" incluyendo="" innaeus="" insectos="" instituto="" internacional="" introducci="" italia="" kettle="" km="" la="" largo="" las="" lejano.="" lengua="" lgica="" lieja="" llegar="" lo="" los="" ltimos="" m="" manera="" mayo="" mecanismos="" media="" mediados="" medicina="" medio="" mediterr="" mellor="" menos="" metros="" mica="" miembros="" mientras="" mixtos="" modos="" mosquitos="" mucho="" mundial="" n.="" n="" nales="" nbsp="" nea="" no="" noviembre="" ntesis="" nueva="" nuevas="" nuevos="" numerosa="" nunca="" o:="" o="" objetivo="" obligatoria="" observa="" obsoletus="" occidental="" ocupa="" ocurrido="" odo="" odos="" organizaci="" oriental="" oriente="" origen="" originaron="" os="" otra="" otras="" otros="" ownes="" p="" para="" parec="" parecen="" parte="" participaci="" penetrado="" peque="" per="" pertenecientes="" philip="" picadores="" pirbright="" poblaci="" podr="" por="" portugal="" pr="" predominar="" preocupaci="" presentar="" presentes="" primavera="" primera="" primero="" principal="" principios="" productos="" proporcionar="" pueden="" pulicaris="" que="" reas="" recogidas="" reino="" relacionado="" repercute="" resumen="" rm="" s.="" s="" saegerman="" sanidad="" scoticus="" se="" seguido="" segundo="" seis="" ser="" serotipos="" setiembre="" sicamente="" sicilia="" sido="" sistema="" sistemas="" situaci="" situado="" socioecon="" son="" su="" sucinta="" susceptibles="" tambi="" tan="" tanto="" tica="" tico="" ticos="" tienen="" transportados="" tropical="" tulo="" uadro="" un="" una="" uni="" unido="" universidad="" var="" varios="" vector="" vectores="" vectorial="" velocidad="" verano="" veterinaria="" vez="" viejo="" virus="" vla-16="" vla-1="" vla-2="" vla-4="" vla-9="" vla-="" vla="" vuelo="" ximo="" y="" zonas=""> LESIONES GRAVES DE LA LENGUA AZUL EN GANADO OVINO Las lesiones graves de la LA en ganado ovino son muy variables. Al examen externo se observa descarga nasal serosa que puede llegar a ser moco purulento con costras secas en los orifi cios nasales, morro congestivo o ulceroso, espuma alrededor de la boca e infl amación de los labios, nariz, cara, área ínter mandibular, párpados y a veces orejas (2, 3, 6). La hiperemia de la piel se puede extender a todo el cuerpo, incluyendo las áreas axilar e inguinal. Con el tiempo, pueden producirse costras y excoriación pero el cambio más prominente en la piel es la congestión de las bandas coronarias de las pezuñas y de las áreas interdigitales. El enrojecimiento puede venir acompañado de petequias o equimosis que se extiende hasta los cuernos (2, 6). La congestión, el edema, las petequias o las equimosis se pueden observar en la mucosa de la cavidad oral con excoriaciones en áreas expuestas a abrasión 7 54 mecánica, a saber, los labios, la lengua, la almohadilla dentaria, los carrillos enfrente de los molares y a veces el paladar duro. Las lesiones y ulceraciones pueden estar cubiertas por tejido necrótico gris. En ocasiones, la lengua puede estar infl amada, congestiva o cianótica (“lengua azul”). En el retículo y en el rumen puede existir hiperemia y erosiones ocasionales en las papilas y láminas. El esófago puede sufrir lesiones similares (2, 6). Las lesiones del tracto respiratorio incluyen la congestión, edema, hemorragias y a veces cianosis de la mucosa nasal, laringe y faringe. Puede darse la congestión de la tráquea. Los pulmones pueden estar hiperémicos con edema alveolar e intersticial grave, espuma en el árbol traqueobronquial y, a veces, exceso de fl uidos en la cavidad torácica. El saco pericárdico puede presentar petequias y exceso de fl uido (Foto 23) (1, 2, 3, 6). Una lesión típica, casi patognomónica, es una hemorragia de tamaño variable en la túnica media de la arteria pulmonar (Foto 24), cerca del corazón. Hemorragias similares pueden ocurrir en la aorta y otras arterias grandes. Las petequias subepicárdicas y subendoteliales y las equimosis son habituales, especialmente en el ventrículo izquierdo. (1, 2, 3, 6) Pueden existir áreas localizadas gris-blancas de necrosis y focos de hemorragia en el miocardio, normalmente en los músculos papilares. En los músculos del esqueleto se pueden observar áreas gris-blancas de degeneración y necrosis, así como placas hemorrágicas. El subcutis y las fascias intermusculares se infi ltran con exudados amarillos y gelatinosos, hemorragias y contusiones (2, 6). Existe también congestión y se producen hemorragias en la mayoría de los tejidos, en particular los nódulos linfáticos, amigdalas, riñones y bazo (1, 2).

LESIONES GRAVES DE LA LENGUA AZUL EN GANADO BOVINO Las lesiones de necropsia de la LA en el ganado bovino no son muy diferentes de las observadas en las ovejas. Las lesiones más destacadas afectan a la piel, la boca y las pezuñas (2, 4, 5, 6). Las lesiones de la piel se caracterizan por un edema grave con pliegues gruesos que aparece en las áreas torácicas, cervical y dorsal. Sobre estas áreas pueden aparecer exudados secos y costrosos y pelo encrespado. Las costras siguen a las úlceras y a las vesículas. Las fosas nasales externas pueden presentar erosiones que den lugar a úlceras a veces recubiertas con costras que se desprenden. En la boca, se observan lesiones vesiculares que evolucionan a úlceras, a veces cubiertas con exudados necróticos grisáceos en la mucosa oral y la almohadilla dental. La lengua no suele estar afectada. Lesiones parecidas ocurren en el pezón (Foto 25). En las pezuñas, se observa hiperemia alrededor de las bandas coronarias, a veces con fi suras. Sin embargo, todas las lesiones descritas en ovejas pueden aparecer en ganado bovino (1, 2, 4, 5, 6). La infección por VLA durante el embarazo puede causar anormalidades graves en los fetos, incluyendo hidrocefalia, porencefalia, encefalitis focal y displasia retinal tanto en ganado ovino como bovino. Se han descrito también artrogriposis y anormalidades maxilares y bucales (2, 5, 6). Para concluir, las lesiones graves causadas por LA pueden ser parecidas en ganado bovino y ovino. Sin embargo, las observaciones de campo revelan que, en ambas especies, los animales exhiben una intensidad de lesiones macroscópicas y matrices tremendamente variables.

 DIAGNÓSTICO DIFERENCIAL DE LENGUA AZUL RICARDO BEXIGA Escuela de Veterinaria, Universidad de Glasgow, Reino Unido HUGHES GUYOT Facultad de Medicina Veterinaria, Universidad de Lieja CLAUDE SAEGERMAN Facultad de Medicina Veterinaria, Universidad de Lieja Existen varias enfermedades con síndromes clínicos parecidos a los de la lengua azul (LA) en ganado ovino y bovino. La diferenciación depende no sólo de los signos clínicos sino de las características epidemiológicas, incluyendo morbilidad, mortalidad, su cáracter infeccioso y estacionalidad. En este capítulo se presentan sólo los síndromes clínicos más importantes (Cuadros V y VI).

DIAGNÓSTICO DIFERENCIAL EN GANADO BOVINO Para el ganado bovino, estos síndromes clínicos incluyen enfermedad de las mucosas (EM), fi ebre catarral maligna (FCM), rinotraqueitis infecciosa bovina (RIB), fi ebre aftosa (FA), estomatitis vesicular, peste bovina y la fi ebre de Rift Valley (FRV). Además, las enfermedades que den lugar a cojera, estomatitis o lesiones de tipo fotosensible deben tenerse en cuenta cuando existen signos clínicos que sugieren la presencia de la LA (véase Capítulo 6). 8 58 Los animales afectados por EM, causada por el virus de la diarrea viral bovina, pueden diferenciarse por la presencia de diarrea y ulceración interdigital (Foto 26), con depresión marcada y apetito disminuido. En la epizootia actual de LA, la ulceración interdigital rara vez se ha observado en ganado bovino y la diarrea ha sido un signo clínico poco común. La enfermedad de la mucosas tiende a ser esporádica con morbilidad baja y casi un 100% de mortalidad, aunque existe una forma crónica de la enfermedad, caracterizada por signos clínicos más leves. El virus de la diarrea viral bovina se da en casi toda Europa, con la excepción de Noruega, donde se erradicó hace poco (8). La fi ebre catarral maligna puede diferenciarse en gran parte por la presencia de opacidad de la córnea (Foto 27), aumento bilateral de los nódulos linfáticos, fi ebre alta y persistente y, como con EM, una depresión más grave que la detectada en la LA. Tiende a ser esporádica con mortalidad alta, aunque se dan brotes ocasionalmente (1). Se da en la mayoría de los países de Europa (7). La rinotraqueitis infecciosa bovina se puede diferenciar de la LA por la ausencia de lesiones orales y cutáneas y el predominio de signos en el tracto respiratorio, tales como descarga nasal abundante (Foto 28), estridor y tos (6). La morbilidad puede ser alta pero la mortalidad es relativamente baja. Austria, Dinamarca, Finlandia, Noruega, Suecia y Suiza han erradicado RIB y existen programas nacionales de erradicación en otros países europeos. Los casos de fi ebre aftosa (FA) tienden a presentar vesículas en la banda coronaria y en el espacio interdigital (3), que están ausentes normalmente en los casos de LA (Foto 29). El tipo de lesiones orales características de la FA tienden a ser vesiculares y, por tanto, ligeramente distintas de las lesiones típicas de la LA. Debido a su naturaleza altamente contagiosa, es habitual que la morbilidad de la FA sea alta. En el verano de 2007, hubo un brote de FA en el Reino Unido y la enfermedad se considera enzoótica en la región de Anatolia en Turquía. 59 La estomatitis vesicular es clínicamente parecida al FA pero no se ha detectado su presencia en Europa desde hace varias décadas. La peste bovina deberia ser eradicada en 2010 (9). Está ya prácticamente extinguida en todo el mundo. No se ha detectado ningún caso en Europa desde hace muchos años. El último brote tuvo lugar en Turquía en 1996 (9). La fi ebre del Rift Valley tiende a causar enfermedad clínica más grave en animales jóvenes y los abortos son frecuentes (4); esta enfermedad es una zoonosis y nunca se ha detectado en Europa. El veterinario clínico debería tener en cuenta también que en casos de la LA más leves pueden presentarse menos signos clínicos. En tales casos, se debe considerar un grupo distinto de enfermedades. Las lesiones erosivas en el ganado bovino pueden estar causadas por el virus de la estomatitis papular, varios hongos (estomatitis micótica), Fusobacterium necrophorum y ocasionalmente el uso de ciertos alimentos (trigo tratado con soda caústica). El virus de la pseudoviruela vacuna y la mamilitis bovina herpética pueden dar lugar a erosiones erosivas en los pezones. Las lesiones cutáneas a lo largo de la LA zona dorsal que se han detectado en un momento tardío en el curso de la LA se deberían diferenciar de la fotosensiblilización, en la que las lesiones cutáneas constituyen el único signo crítico. Es más, en el caso de la LA, estas lesiones cutáneas no se dan únicamente en animales que han estado pastando al aire libre .

DIAGNÓSTICO DIFERENCIAL EN GANADO OVINO Para el ganado ovino, el diagnóstico diferencial de la LA incluye ectima contagioso, neumonía, viruela ovina, fi ebre aftosa, estomatitis vesicular, peste de pequeños rumiantes (PPR), peste bovina, FVR, oestrosis y dermatosis ulcerosa. El ectima contagioso puede diferenciarse por la naturaleza prólifi ca de sus lesiones en los labios (Foto 30), la ausencia de descarga oculonasal y la ausencia de pirexia. Suele darse en época de parición, lo que puede no 60 coincidir con una época en la que el vector LA esté activo. La morbilidad puede ser alta, pero la mortalidad es baja. Tiene una distribución mundial y es una zoonosis (5). La fi ebre aftosa en ovejas es clínicamente parecida a la enfermedad en ganado bovino pero más leve, por eso, el signo clínico que más la diferencia de la LA es la ausencia de la apariencia edematosa de la cabeza (3). La viruela ovina se puede diferenciar principalmente por la ausencia de cojera y por la rareza de los cambios edematosos que son característicos de la LA. Tanto la morbilidad como la mortalidad pueden ser altas. La viruela ovina se dio en Grecia en 2007 (7) y también en Turquía. La PPR puede diferenciarse de la LA por la ausencia de edema de la cabeja y la ausencia de cojera, ambos síntomas característicos de la LA. Además, la PPR se caracteriza por una diarrea severa y una mortalidad alta, que no son típicas de la LA, aunque se puede observar diarrea en algunos casos. La PPR existe todavía Turquía. La FVR clínica puede darse en ovejas de todas las edades, pero es más grave en corderos jóvenes. Se puede diferenciar de la LA por la presencia de diarrea hemorrágica, mayor frecuencia de abortos y la alta tasa de morbilidad (2). La estomatitis vesicular en ovejas tiende a causar signos clínicos más leves que en el ganado bovino y la ausencia de lesiones edematosas (presentes en la LA) es probablemente el signo clínico diferenciador más útil. La neumonía de etiología variada puede parecer similar al LA debido a la presentación de pirexia, taquipnea y descarga nasal; sin embargo, la ausencia de cojera y de lesiones edematosas y erosivas deberían permitir la diferenciación de LA. 61 El Oestrus ovis puede tener una distribución geográfi ca parecida y la estacionalidad puede causar signos clínicos semejantes a las de la LA, y debe, por tanto, considerarse en el diagnóstico diferencial (2). Lo que hace que se diferencia mejor de la LA es la ausencia de cojera y de lesiones edematosas en la cabeza. Debe tenerse en cuenta que en casos menos graves de la LA en ovejas, pueden observarse menos signos clínicos. En tales casos debe considerarse un grupo distinto de enfermedades. Las lesiones erosivas orales en las ovejas pueden ser causadas por Fusobacterium necrophorum. El edema en la zona de la cabeza puede deberse a fascioliasis, parásitos gastrointestinales (por ejemplo hemoncosis aguda), edema maligno debido a infección con varios miembros del género Clostridium o a paratuberculosis. La cojera puede ser causada por pododermatitis necrosante (pietín), dermatitis digital contagiosa ovina o lesiones artríticas. Las lesiones cutáneas deberían diferenciarse de la fotosensibilización primaria o secundaria. Además, los diagnósticos diferenciales para las cabras que muestran signos clínicos de LA incluyen, eritema contagioso, FA, viruela caprina, peste de pequeños rumiantes y peste bovina. Es importante resaltar que en casos poco frecuentes, la LA puede darse junto con alguna de las enfermedades mencionadas anteriormente. Esto muestra la importancia del exámen clínico completo (véase Capítulo 11) y de la confi rmación obligatoria del diagnóstico mediante técnicas de laboratorio. Es más, puede que no todos los signos clínicos estén presentes en un animal individual, sino que se observen muchas de las características entre los miembros de un mismo rebaño. El serogrupo del virus de la lengua azul (VLA) incluye 24 serotipos, que pueden dividirse en distintos topotipos dependiendo del origen geográfi co (11). El genoma del VLA consiste en 10 moléculas de ARN bicatenario (32), que codifi can para 7 proteínas estructurales y 4 no estructurales. VP2 y VP5 son dos proteínas variables localizadas en la cápside externa del virión que determinan la variabilidad antigénica del virus y el serotipo (3, 8, 10, 14, 33). VP7 es el antígeno inmunodominante principal del serogrupo (12, 15, 24) y se usa generalmente para la identifi cación del serogrupo de la lengua azul mediante ensayos serologicos (13). VP1 es la ARN polimerasa dependiente del ARN viral que se encuentra en el subnúcleo del virión (25). Se han identifi cado cuatro proteínas no- estructurales, PNE1, PNE2, PNE3 y PNE3A (20, 26). 9 69

DETECCIÓN DEL VIRUS DE LA LENGUA AZUL La identifi cación del VLA puede llevarse a cabo mediante aislamiento del virus, ensayo inmunosorbente ligado a enzimas (ELISA) y transcripción reversa combinada con reacción en cadena por polimerasa (RT-PCR). El aislamiento del virus requiere mucho tiempo antes de que los resultados estén disponibles y es especialmente laborioso (38). Normalmente, se requiere la inyección intravascular en huevos de pollo embrionados o la inyección intracraneal en ovejas o pequeños ratones antes de pasar al cultivo celular (6). El aislamiento directo en el cultivo celular es menos sensible y puede fallar en la detección de muestras debilmente positivas (2, 7). La detección del genoma viral por RT-PCR es un método rápido y conveniente para la identifi cación del VLA (véase Ref. 38). Se han desarrollado varios protocolos RT-PCR que detectan los segmentos 2, 3, 6, 7 o 10 en los últimos 20 años (1, 2, 17, 19, 34, 35, 37). Estos tests están reconocidos por la Organización Mundial de Sanidad Animal (OIE), que recomienda la PCR anidada para amplifi car el segmento 5 del VLA (30). RT-PCR suele tener más sensibilidad que el aislamiento del virus y puede dar un resultado positivo aún varias semanas después de la infección (18). Los métodos convencionales RT-PCR requieren electroforesis en gel de agarosa, lo que limita el número de muestras que se pueden analizar en un día. Durante los últimos tres años, se han desarrollado los ensayos cuantitativos en tiempo real por RT-PCR (RT-qPCR) para la detección de ciertas vacunas y/o cepas de VLA (5, 16, 21, 22, 23, 36). Dado que la detección de los productos PCR se basa en las intensidades de fl uorescencia, ésta aumenta el rendimiento del test y reduce el riesgo de contaminación. Se ha difi cultado el desarrollo de un ensayo universal por la gran diversidad de VLA. Recientemente, sin embargo, se han descrito dos ensayos universales RT-qPCR que permiten la detección de todos los serotipos de LA (30, 27). 70 MUESTRAS BIOLÓGICAS Las muestras de sangre deben recogerse con el ácido etilendiamino tetraacético (EDTA) como anticoagulante. No se recomienda el uso de heparina como anticoagulante porque puede interferir con el RT-PCR. Los tejidos se deben examinar inmediatamente o almacenar a -80ºC hasta que se usen para la extracción del ácido nucleico. Se puede utilizar un medio de almacenamiento, como RNAlater® para evitar la degradación del ARN.

AISLAMIENTO DEL VIRUS EN HUEVOS DE POLLO EMBRIONADOS Y CULTIVO DE CÉLULAS Se puede llevar a cabo el aislamiento del virus en huevos de pollo embrionados seguido de entre uno y tres pasos de cultivo de células como describe Bréard et al., (4). Se inoculan grupos de cinco huevos embrionados por vía intravenosa con 100μl de una solución de glóbulos rojos hemolisados, diluidos en proporción 1-10 de muestro sospechoso. Los huevos se incuban durante 5 días a 35ºC y se examinan diariamente utilizando un ovoscopio. Los embriones que mueren entre 2 y 5 días tras la infección se homogenizan individualmente en 10 volúmenes de Eagle medium (Invitrogen, Carlsbad, CA, USA). Los homogenatos se clarifi can por centrifugación a 10.000 g por 10 minutos a 4ºC y se inoculan en células de riñón de hamster bebé (BHK) – 21 (4). Si se hace una serie de diluciones 1/10 se puede calcular el título fi nal del virus utilizando el método Karber. El virus se puede aislar también en BHK-21, riñón de mono verde africano (Vero) o células de insecto en cultivo. Dado que el aislamiento del virus en células de cultivo suele ser menos satisfactorio que en huevos embrionados, se recomienda comenzar con homogenatos de huevos embrionados. Después de lavar las monocapas de células cultivadas en placas de cultivo de 24 pocillos, 71 se añade un volumen de 300μl de homogenato. Las monocapas de células se incuban durante cinco días a 37ºC en 5% CO2 con humedad, y se observan regularmente para comprobar la aparición de efecto citopatogénico (ECP). Si no aparece el ECP, se realiza un segundo pasaje en cultivo de células después de congelarlas y descongelarlas. El virus se puede identifi car utilizando un test de neutralización de virus. El VLA en potencia se cultiva en cultivos de células y se titula. Se usan placas de microtitulación de fondo plano y se mezca un volumen de 50μl de un antisuero específi co de serotipo bien defi nido en una dilución predeterminada, que se sepa que es capaz de neutralizar el virus, con un volumen igual de 100 CCID50 (50% de la dosis infectiva del cultivo celular) del virus que va a ser identifi cado. Después de una incubación de una hora a 37ºC, se añade un volumen de 100μl con 104 células a cada pocillo. Utilizando un microscopio, se comprueba la presencia de ECP en los pocillos tras una incubación de entre tres y cinco días a 37ºC. Los pocillos que contengan sólo células o células y antisuero no deberían mostrar ECP. En contraste, los pocillos que contuvieran virus no neutralizado deberían mostrar ECP. EXTRACCIÓN DE ÁCIDOS NUCLEICOS, DESNATURALIZACIÓN Y DETECCIÓN Como se ha comentado anteriormente, existen varios protocolos. El siguiente protocolo se presenta como ejemplo (descrito en 30, 31). Las muestras de sangre están sujetas al siguiente pre-tratamiento antes de la extracción del ARN: 250μl de células de sangre roja se lavan con PBS y se lisan con 1ml de agua de dietilporicarbonato (DEPC). Después de centrifugarlas durante 10 minutos a 10.000 g, se descarta el sobrenadante y el pellet se resuspende en agua DEPC 250μl. Se extrae el ARN total de 250μl células rojas lisadas o de 250μl sobrenadantes de células infectadas con BHK-21 con 750μl 72 de reactivo Trizol-LS (Gibco-BRL), según el método recomendado por el fabricante. El ARN precipitado se suspende en 30μl de agua PEPC. Antes de la RT-PCR, las muestras de ARN se desnaturalizan calentándolas durante 3 minutos a 95ºC con 10% de dimetilsufoxido (DMSO, Sigma). El hidróxido de Metilmercurio, que recomienda la OIE como agente desnaturalizador, es altamente tóxico y no está disponible en algunos países. RT-QPCR ESPECÍFIO PARA SEGMENTOS 1 Y 5 DE VIRUS DE LENGUA AZUL ■ Cebadores y sondas El primer RT-PCR cuantitativo (RT-qPCR_S1) amplifi ca una región de 357 bases del segmento 1 de VLA. El segundo ensayo RT-qPCR (RT-qPCR_S5) genera un amplicón de 75 bases en el extremo 5’ del segmento 5. Se eligen estas regiones porque la alineación de secuencias disponible en bases de datos públicas con el software Clustal W (29) mostró que ambas contenían secuencias sufi cientemente conservadas para diseñar cebadores PCR y sondas TaqMan hibridantes para las cepas de 24 serotipos. Los cebadores y la sonda específi cos para el segmento 5 contienen bases degeneradas, lo que asegura un amplio reconocimiento de las diversas cepas de lengua azul. El extremo 3’ de la sonda específi ca para el segmento 1 se conjuga con el ligando de unión al surco menor (MGB), que aumenta su temperatura de hibridación. La sonda específi ca para el segmento 2 incluye 6 restos de ácido nucleico cerrado (LNA ) (28), lo que también aumenta la temperatura de hibridación (Cuadro VII). Los residuos de LNA se prefi eren a los de MGB en la sonda específi ca del segmento 5 porque se pueden incorporar en cualquier punto y, por tanto, confi eren mas fl exibilidad cuando se diseña la sonda. 73 ■ RT-qPCR fl uorogénico específi co para el segmento 1 El RT-qPCR_S1 se ha desarrollado y validado como un procedimiento de único paso que combina la transcripción reversa y las reacciones cuantitativas PCR. Las reacciones se preparan utilizando Reactivos del Núcleo Taqman EZ RT-PCR (Applied Biosystems) en un volumen fi nal de 25μl que contenga un buffer 1x EZ, 5mM Mn ++, 300μM de cada dNTP, 2,5 unidades de polimerasa rTth, 0,25 unidades de UNG, 300 nM de cada cebador (BTV_S1_F_2-23 y BTV_S1_R_343-325, Eurogentec), 200 nM de una sonda TaqMan conjugada a FAM en el extremo 5’ y a MGB en el extremo 3’ (BTV_S1_P_25-37, Applied Biosystems) y 5μl de ARN. La amplifi cación/detección de RTqPCR en tiempo real se lleva a cabo en un termociclador Applied Biosystems 7900 utilizando el siguiente programa: un primer ciclo de 2 minutos a 50ºC, 30 minutos a 60ºC y 5 minutos a 95ºC seguido de 40 ciclos de 20 segundos a 94ºC y un minuto a 60ºC. ■ RT-qPCR fl uorogénico específi co para el segmento 5 El RT-qPCR_S5 se ha desarrollado y validado como un procedimiento de dos pasos con reacciones de transcripción reversa y PCR cuantitativa separadas. La transcripción reversa se realiza utilizando el Reverse Transcription Reagents (Applied Biosystmes). Cada 10μl de reacción contiene 2,5μM de hexámeros aleatorios, 5.5 mN MgCl2 , 0.5 mM de cada dNTP, 0.4 IU inhibidor de RNAsas, 1.25 IU MultiScribe Reverse Transcriptasa y 2μl de ARN. La mezcla se incuba durante 10 minutos a 25ºC, 30 minutos a 48ºC y 5 minutos a 95ºC en un termociclador Gene Amp 9600 (Perkin Elmer). Las mezclas de 20μl qPCR a tiempo real consistieron en 10.0μl 2x de concentrado TaqMan Universal PCR Master Mix (Applied Biosystems), 375 nM (betaactin) o 500 nM (lengua azul) de cada cebador, 250 nM de la sonda Taqman conjugada a FAM en el extremo 5’Y a TAMRA en el extremo 3’ y 5μl cADN. 74 Las condiciones de los ciclos fueron las siguientes: 1 ciclo a 95ºC durante 20 segundos, 45 ciclos de 1 segundo a 95ºC y 20 segundos a 60ºC y llevados a cabo en un termociclador Applied Biosystems 7900. La sensibilidad diagnóstica y la especifi cidad de este test se estiman en 99,5% (95% CI: 99-100) y 98,5% (95% CI: 97,1-100) respectivamente, basadas en un análisis bayesiano de muestras de campo de animales con un status infeccioso desconocido durante la epidemia de VLA 8 en Bélgica y comprobadas con el cELISA y el RT-qPCR (31). RT-PCR CONVENCIONAL ESPECÍFICO PARA EL SEGMENTO 9 DE LENGUA AZUL Este RT-PCR convencional específi co de un serogrupo utilizado habitualmente en los laboratorios se destina al segmento 9 del VLA (39). Las reacciones de RT-PCR se preparan con el Kit RT-PCR de un Paso (QIAGEN) y contienen 1x buffer Qiagen, 400μM de cada dNTP, 0,6μM de cada cebador (S9=:GTTAAAAAATCGCATATG y S9M: CTACGTCAAGGTAC), 1μl de mezcla de enzimas y 2.5μl de ARN por 25μl de reacción. Las muestras se incuban durante 30 minutos a 45ºC y 15 minutos a 94ºC antes de una amplifi cación de 40 ciclos que comprenden 30 segundos a 94ºC, 30 segundos a 54ºC, 1 minuto a 72ºC y una extensión fi nal del producto de PCR durante 10 minutos a 72ºC. Los productos de PCR se analizan en un gel de agarosa al 2% marcado con 1μg/ml de bromuro de etidio. 75 RT-QPCR FLUOROGÉNICO PARA LA DETECCIÓN Y CUANTIFICACIÓN DE mARN BETA ACTIN Se ha diseñado un RT-PCR cuantitativo en tiempo real para el beta-actin mARN para medir el nivel de control endógeno (30). Las secuencias de cebadores y de la sonda se dan en el Cuadro VII. El RT-qPCR en dos pasos se lleva a cabo según los protocolos de dos pasos descritos para un RT-qPCR específi co para el segmento 5 del VLA, pero con 300 nM de cada cebador (ACT_F_1005- 1029 Y ACT_R_1135-1114, Eurogentec) y 200nM de la sonda ACT_P_1081- 1105 (Eurogentec). PREPARACIÓN DE LOS CONTROLES SÍNTETICOS DEL ARN Los controles sintéticos del ARN para los segmentos 1 y 5qPCR del VLA y para el beta-actin qPCR se pueden preparar insertando los productos de PCR, obtenidos con los cebadores descritos en el Cuadro VII, en un vector pCRII-TOPO por clonación TA (Invitrogen). Los plásmidos recombinantes se purifi can con el Pure Yield Plasmad Midiprep System (Promega) y linearizado con endonucleasa Spel (Roche). El ARN se sintetiza entonces in vitro con el sistema Riboprobe T/ (Promega). La plantilla de ADN se disuelve con DNasa libre de ARnasa (Promega) y el ARN cuantifi cado por espectrofotometría. 76 Cuadro VII: Cebadores y sondas

 DETECCIÓN DE ANTICUERPOS DEL VIRUS DE LA LENGUA AZUL MEDIANTE ELISA Los anticuerpos anti VLA pueden detectarse utilizando ELISas caseros o comerciales. El siguiente protocolo es un ejemplo de un ELISA competitivo: 50μl de muestras de suero y kits de control se diluyen en 50μl de buffer de disolución y se añaden a placas pre-impregnadas de VP7. Además de los kit de control distribuidos por el fabricante, se recomienda incluir una secuencia de disolución en dos partes de un suero de referencia positivo de anticuerpos anti VLA como patrón de trabajo en cada ensayo para monitorizar la actuación del ELISA a tiempo, como Goris y De Clercq describen para fi ebre aftosa (2005) (9). Después de 45 minutos de incubación a temperatura ambiente, se añaden 100 μl de anti VP7 conjugado con peroxidasa para ligar a los epítopes restantes libres de VP7. Tras 30 minutos de incubación a temperatura ambiente, las microplacas se lavan tres veces con anterioridad a la incorporación de 100 μl solución de substrato 3,3´, 5, 5’ tetrametilbencidina. La reacción de color se para después de 15 minutos y la absorbancia se mide espectrofotometricamente a 450nm. Los resultados se expresan en porcentaje de inhibición y porcentaje de negatividad comparados respectivamente al control positivo o negativo y transformados en un resultado positivo, negativo o dudoso según los parámetros del valor de corte. PCR target / name Primer/probe name Sequence (5' - 3') BTV_S1_F_2-23 TTAAAATGCAATGGTCGCAATC BTV_S1_R_343-325 TCCGGATCAAGTTCACTCC BTV_S1_P_25-37 FAM-CCGTGCAAGGTGC-MGB BTV_S5_F_1-19 GGCAACYACCAAACATGGA BTV_S5_R_76-57 AAAGTYCTCGTGGCATTWGC BTV_S5_P_49-27 FAM-CYCCACTGATRTTGTATTTTCTCAA-TAMRA ACT_F_1005-1029 CAGCACAATGAAGATCAAGATCATC ACT_R_1135-1114 CGGACTCATCGTACTCCTGCTT ACT_P_1081-1105 FAM-TCGCTGTCCACCTTCCAGCAGATGT-TAMRA BTV segment 1 / RT-qPCR_BTV_S1 BTV segment 5 / RT-qPCR_BTV_S5 beta actin / RT-qPCR_ACT 77 La sensibilidad diagnóstica y la especifi cidad de este test se estiman en 87.8% (95% CI: 85.1-91.1) y 98.2% (95% CI:96.3-99.6) respectivamente, basadas en un análisis bayesiano de muestras de campo de animales con un status infeccioso desconocido durante la epidemia de VLA 8 en Bélgica y comprobadas con el cELISA y el RT-qPCR (31).La lengua azul (LA) es una enfermedad de declaración obligatoria de notable preocupación socio-económica y de gran importancia en el comercio internacional de animales y de productos animales. Antes de 1998, la LA se consideraba una enfermedad exótica en Europa. Entre 1998 y 2005 al menos seis cepas de virus pertenecientes a cinco serotipos (VLA-1, VLA-2, VLA-4, VLA-9 Y VLA-16) han estado continuamente presentes en la cuenca mediterránea. Desde Agosto de 2006, VLA-8 ha causado un brote epizoótico grave e inesperado de LA en el norte de Europa. La recrudescencia, la extensión de las infecciones por VLA-8 en el norte de Europa durante 2007 sugieren que se han cumplido los requisitos para que el VLA se establezca en esta área. Un conocimiento detallado de la patología y la biología de las especies Culicoïdes que se dan en el norte de Europa es de vital importancia para entender su comportamiento y para mejorar el control de la LA. En cuanto a la biología del vector, no se sabe lo sufi ciente sobre el Culicoïdes (esto es, actividad durante el día, hibernación, reserva del virus, control).

10 CONCLUSIÓN: LAS LECCIONES APRENDIDAS SOBRE LA LENGUA AZUL 81 La lengua azul en el norte de Europa es un nuevo reto para los veterinarios y el primer paso es aún el examen clínico de los casos sospechosos. Existen ciertas enfermedades con síndromes clínicos parecidos al de LA en ganado ovino y bovino. Su diferenciación depende no solo de los signos clínicos sino de sus características epidemiológicas, incluyendo la morbilidad, mortalidad, infectividad y estacionalidad. Dada la diversidad de los signos clínicos y el hecho de que ninguno de ellos es patognomónica para LA, es invevitable realizar pruebas de laboratorio para confi rmar el diagnóstico inicial. Uno de los objetivos principales de la OIE es prevenir la propagación de las enfermedades en el contexto del comercio internacional. Esto se logra estableciendo estándares internacionales en una amplia gama de enfermedades animales. En el caso de la LA, estos estándares están publicados en el Código Sanitario para los Animales Terrestres (Código Terrestre) y el Manual de Pruebas de Diagnóstico y Vacunas para los Animales Terrestres (Manual Terrestre). Además, la política de la Unión Europea con respecto al LA ha evolucionado durante los últimos diez años en paralelo con la dinámica de la enfermedad en el continente europeo, la experiencia adquirida y el conocimiento científi co disponible. En lo que respecta a la profi laxis, la mejor opción estratégica para controlar los brotes clínicos de LA en las zonas enzoóticas de Europa puede ser vacunar a los animales susceptibles para proteger de la infección, después de una consideración cuidadosa de las ventajas y desventajas de las vacunas disponibles. 82 CLAUDE SAEGERMAN Facultad de Medicina Veterinaria, Universidad de Lieja, Bélgica AXEL MAUROY Facultad de Medicina Veterinaria, Universidad de Lieja, Bélgica HUGHES GUYOT Facultad de Medicina Veterinaria, Universidad de Lieja, Bélgica La Agencia Federal Belga para la Seguridad de la Cadena Alimentaria estableció inicialmente un formulario de evaluación clínica basado en las siguientes publicaciones: – Vademecum Fièvre Catarrhale Ovine (Bluetongue) à l’usage de vétérinaires sanitaires (vademécum de la lengua azul para inspectores veterinarios) publicado por la CIRAD (http//bluetongue.cirad.fr/ressources/ publications/ouvrages/la_bluetongue/vademecum_fievre_catarrhale_ ovine_bluetongue) – La tarjeta técnica de la OIE sobre LA (www.oie.int/eng/maladies/fi ches/a_ A090.htm) – Las hojas de enfermedad clínica elaboradas por el AVIS Consortium (Instituto de Sanidad Animal; Organización de Alimento y Agricultura de las Naciones Unidas; Organización Mundial de Sanidad Animal y Telos ALEFF Ltd) (www.fao.org/ag/aga/AGAH/EMPRES/GEMP/avis/A090- bt/tools/0-imag-contact-sheet.html).

11 LENGUA AZUL EN RUMIANTES: UN INFORME CLÍNICO ESTANDARIZADO PARA UTLIZAR CON LAS DISTINTAS ESPECIES 83 La versión fi nal del formulario incorpora mejoras hechas durante las visitas a granjas infectadas con el virus de la lengua azul (serotipo 8). El formulario está dividido en subgrupos de signos clínicos, tales como signos clínicos generales, digestivos, cutáneos, locomotores (músculoesqueléticos), neurológicos, respiratorios y reproductivos. Otros datos, como una descripción del animal y la fecha de la primera aparición de los signos clínicos y su duración, se listan también. La versión fi nal del formulario clínico para el examen de los animales de distintas especies se muestra a continuación.

No hay comentarios:

Publicar un comentario en la entrada