lunes, 2 de abril de 2012

Mycoplasma hemotrópico en gatos de Israel. Orit Witman. 2010

 Memoria de Título
Escuela de Medicina Veterinaria
Universidad de Chile

Ensayo de PCR para determinar la presencia y la identidad de Mycoplasma hemotrópico en gatos de Israel
Orit Witman


1.1. RESUMEN
Mycoplasma hemotrópico (previamente llamado Haemobartonella) es el agente
causal de la Anemia Infecciosa Felina (AIF). Tres especies o especies candidatas han sido
reconocidas en los felinos: Mycoplasma haemofelis (M haemofelis), Candidatus
Mycoplasma haemominutum (CM haemominutum) y Candidatus Mycoplasma turicensis
(CM turicensis). Este estudio ha sido el primero en realizar ensayo de PCR para la
detección de Mycoplasmas hemotrópicos en Israel. Los objetivos de este estudio fueron la
evaluación de la prevalencia e identidad de los Mycoplasmas hemotrópicos presentes en los
gatos de Israel y comparar la prevalencia y la distribución de las especies en diferentes
poblaciones de gatos.
Muestras de sangre de gatos de diferentes orígenes de acuerdo a su origen, género y
edad fueron colectadas y el ensayo de PCR fue realizado utilizando partidores universales
de Mycoplasma. Además, se realizó un ensayo de PCR para la detección del Virus de la
Inmunodeficiencia Felina (VIF) y un ensayo serológico de detección del Virus de la
Leucemia Felina (ViLeF). Todos los productos de PCR (Mycoplasma y VIF) fueron
secuenciados para alcanzar una identificación a nivel de la especie.
En el total de muestras evaluadas (n=55), se encontró una prevalencia de 49% de
Mycoplasma hemotrópico, así como, las tres especies de Mycoplasmas hemotrópicos
internacionalmente conocidas, mientras que la especie CM turicensis fue encontrada por
primera vez en Israel. Una diferencia significativa (P<0.005) se encontró en la prevalencia
de las especies de Mycoplasma hemotrópico en gatos de los distintos orígenes. En las
muestras de gatos provenientes tanto del Hospital Veterinario de Bet Dagan o desde el
banco de sangre, en los machos y con estatus de VIF positivo, la especie de mayor
prevalencia fue CM haemominutum, mientras que en las muestras obtenidas desde gatos
callejeros y negativos a VIF, CM turicensis fue la especie más prevalente.
Así en este estudio se concluye que la prevalencia de Mycoplasma hemotrópico en
gatos en Israel parece ser alta. Las tres especies conocidas de Mycoplasma hemotrópico que
los afectan, están presentes en Israel y su prevalencia es aparentemente diferente en gatos
de distintas poblaciones.
2
1.2. SUMMARY
Molecular survey of hemotrophic Mycoplasma species in cats from Israel.
Hemotrophic Mycoplasmas (previously Haemobartonella) are the causative
agents of “Feline Infectious Anemia”. Three spp. or candidate spp. have been
recognized in cats: Mycoplasma haemofelis (M haemofelis), Candidatus Mycoplasma
haemominutum (CM haemominutum) and Candidatus Mycoplasma turicensis (CM
Turicensis). This is the first survey of feline hemotrophic Mycoplasma spp. performed
in Israel using PCR. The goals of the study were to evaluate the prevalence and identity
of the hemotrophic Mycoplasma in cats in Israel and to compare the prevalence and
spp. distribution in different cat populations.
Blood samples of cats from different sources were collected and PCR was
performed using universal Mycoplasma primers. Feline immunodeficiency virus (FIV)
detection was also performed by PCR. Feline leukemia virus was detected by ELISA.
All PCR products (Mycoplasma and FIV) were sequenced to achieve identification at
the species level.
A 49% prevalence rate of hemotrophic mycoplasmas was found among all
samples evaluated (n=55). The three internationally known hemotrophic Mycoplasma
spp. were found and CM turicensis was identified for the first time in Israel. The
samples were divided into distinct sub-groups according to their origin, gender, age and
their FIV status. Significant differences (P<0.005) were found among the hemotrophic
Mycoplasma spp. prevalent in cats from different sources. In cats from the veterinary
hospital or blood bank, males and FIV positive cats, the most prevalent spp. was CM
haemominutum, while in stray cats and FIV-negative cats, CM turicensis was the most
prevalent sp.
The conclusion of this study is that the prevalence of hemotrophic Mycoplasma
infection in cats in Israel appears to be high. The three known hemotrophic
Mycoplasma spp. which infect cats are present in Israel and their prevalence is
apparently different in cats from distinct populations.
3
2. INTRODUCCIÓN
En los últimos años existe un creciente interés en el agente causal de la “Anemia
Infecciosa Felina” (“Hemobartonellosis”), que tras años de ser considerado como
Haemobartonella, perteneciente al orden Rickettsia, fue reclasificado como “Mycoplasma
hemotrópico” (también llamado “Hemoplasma”). La reclasificación se logró a través del
uso de ensayo de reacción en cadena de la polimerasa (PCR) que puso en evidencia la
verdadera naturaleza del agente al analizar un fragmento de su ADN y reconocer la
semejanza estructural que tiene a los miembros del género Mycoplasma.
Antiguamente, el reconocimiento del agente y el diagnóstico definitivo de la
enfermedad, se realizaban solamente por la observación directa de un frotis sanguíneo por
microscopía, prueba que tiene una sensibilidad limitada, consecuentemente la investigación
sobre la enfermedad y el agente etiológico, no daba certeza alguna sobre sus verdaderas
características. En cambio, con el uso de PCR se obtiene una alta sensibilidad, además, se
genera un producto que se puede secuenciar, comparar y analizar filogenéticamente. Esto
ha permitido comprobar la existencia de distintas especies y variedades de hemoplasma.
Por el mismo motivo, el PCR ha permitido conocer la prevalencia, analizar los factores de
riesgo, los cuadros clínicos generados, las relaciones que tiene con otros agentes y
enfermedades, entre otros, lo que explica el aumento actual de las investigaciones sobre el
tema.
Al analizar los resultados de los estudios realizados en distintos lugares del mundo,
se encuentran valores y conclusiones muy variados, lo que sugiere la importancia que
tienen la geografía, el clima, el estatus sanitario y la distribución de las distintas especies de
hemoplasma.
Este estudio fue realizado en la Escuela de Medicina Veterinaria de Koret en
Rehovot, Israel, y fue el primer ensayo de PCR en Mycoplasma hemotrópico en gatos
realizado en este país. El ensayo tuvo la finalidad de comprobar la presencia y definir la
identidad del agente, información que en un futuro cercano permitirá continuar analizando
a las variedades de Mycoplasma hemotrópico presentes en el país y realizar estudios
relacionados con las distintas características de la enfermedad y su epidemiología.
4
3. REVISION BIBLIOGRAFICA
3.1. Historia.
Los organismos antiguamente conocidos como Haemobartonella sp y
Eperythrozoon sp son pequeñas bacterias pleomórficas que parasitan a los glóbulos rojos de
un amplio rango de animales vertebrados. Estos parásitos sanguíneos fueron observados por
primera vez en ratones (E. coccoides) y perros (H. canis) en Alemania en 1928. Desde
entonces, la presencia de estos parásitos fue descrita en cerdos, ovejas, cabras, bovinos,
llamas y alpacas, gatos, perros, ratas, monos e incluso en seres humanos, en todo el mundo.
En el año 1953, Flint y Moss reconocieron a H. felis como el agente causal de la “Anemia
Infecciosa Felina”, una enfermedad contagiosa en los gatos. Dos especies de
Haemobartonella han sido descritas en gatos; el organismo “Ohio” o la forma grande de H.
felis, el agente causal de la enfermedad y el organismo “California” o la forma pequeña,
que parece tener virulencia baja (Messick, 2004).
3.2. Morfología.
Los organismos son gram-negativos, parásitos obligados de los glóbulos rojos que
no han crecido con éxito en ningún medio de cultivo. Pueden tener una forma de rueda,
esférica o de anillo y se sitúan individualmente o en cadenas sobre la superficie del glóbulo
rojo. La diferenciación morfológica entre los dos géneros se basaba en la forma de
presentación sobre la superficie de los glóbulos rojos, siendo la más frecuente en forma de
anillos o libres en el plasma sanguíneo en Eperythrozoon sp en comparación a
Hemobartonella sp (Messick, 2004).
Los hallazgos ultraestructurales muestran que los organismos son redondos a
elongados, de diámetro entre 0,3 y 3 Im y son rodeados por una sola membrana limitante.
A pesar de no tener núcleo, pequeños gránulos y algunas estructuras filamentosas se
encuentran en sus citoplasmas. Los parásitos se adhieren, pero no penetran la superficie de
los glóbulos rojos. Se encuentran en pequeñas depresiones y en los profundos pliegues de la
superficie, con una zona de separación de 15 a 25 nm entre el parásito y la membrana del
glóbulo rojo. Delicadas fibrillas se extienden desde el parásito a esa zona, adjuntando el
organismo a su célula hospedera (Messick, 2004).
5
3.3. Reclasificación.
La confusión sobre la verdadera naturaleza de este agente ha persistido durante los
últimos 50 años. Hasta el año 1993, el orden Rickettsiales contenía 3 familias:
Rickettsiaceae, Bartonellaceae y Anaplasmataceae. Las bacterias hemotrópicas,
Hemobartonella y Eperythrozoon, estaban clasificadas como miembros de la familia
Anaplasmataceae, en base a sus características biológicas y fenotípicas, como son el
pequeño tamaño, la tinción gram negativa, el parasitismo de los glóbulos rojos y la
transmisión mediante artrópodos hematófagos (Willi et al., 2007). Sin embargo, se sostenía
una larga sospecha de que este agente no era un parásito rickettsial y parecía estar más
relacionado con los miembros de la clase Mollicutes. Esta sospecha se basó en la ausencia
de parasitismo intracelular, su pequeño tamaño, la falta de pared celular y de flagelo, la
resistencia a la penicilina y sus análogos y su susceptibilidad a las tetraciclinas (Messick,
2004).
Como los hemoplasmas no se han logrado cultivar con éxito en agar ni en cultivo
celular, el único medio de diagnóstico de los animales infectados era la identificación
microscópica de frotis sanguíneo teñido con Giemsa, siendo un método de poca
sensibilidad de detección. El diagnóstico también se complicaba por la carencia de una
parasitemia identificable en los estados latentes o crónicos de la enfermedad y la rápida
pérdida de la parasitemia luego de la presentación de los signos clínicos en los gatos con
cuadros agudos. La falta de un examen eficiente para el diagnóstico de cuadros agudos y
crónicos, resultó en una enorme controversia en la consideración del verdadero impacto de
esta enfermedad en la población de los felinos (Messick et al., 1998).
Sólo recientemente, un preciso y objetivo medio de clasificación filogenética de
bacterias hizo posible su identificación, a través del análisis de la secuencia del gen 16S
ARN ribosomal (ARNr). En 1997, Rikihisa et al., reportaron por primera vez la secuencia
del gen 16S ARNr de Haemobartonella sp y Eperythrozoon sp. La secuencia se obtuvo
mediante el uso de ensayo de PCR y el consecuente análisis de productos amplificados,
secuenciados y comparados con secuencias conocidas de distintas bacterias (Anaplasma
marginale, Mycoplasma muris, Bartonella henselae, Ureaplasma canigenitalum, entre
otras) (Messick, 2004), determinando que en base a las secuencias encontradas, que
generaron muy pequeña similitud con los organismos Rickettsiales, ellos no pertenecen a la
6
familia Anaplasmataceae o siquiera al orden Rickettsia y su relación filogenética es más
cercana a los Mycoplasmas (Rikihisa et al., 1997).
Posteriormente, fue propuesto que la clasificación taxonómica debía ser modificada
para reflejar los nuevos conocimientos de la afiliación filogenética de Haemobartonella sp
y Eperythrozoon sp con el género Mycoplasma y que la designación “Candidatus” sería
adjuntada a las especies que fueran nuevas y/o no completamente descritas. Entonces, H.
felis (Organismo Ohio o forma grande) fue transferido al género Mycoplasma como
Mycoplasma haemofelis (M haemofelis) y el organismo California o la forma pequeña, que
es una especie con caracterización incompleta, fue designada como “Candidatus
Mycoplasma haemominutum” (CM haemominutum) (Messick, 2004).
3.4. Estudios Filogenéticos.
En el 2003, se publicó un análisis de las especies conocidas de hemoplasma,
incluyendo muestras de sangre de gatos y perros de Europa, Australia, África y Asia, en el
cual fue construido un árbol filogenético, revelando una división de estos organismos en
dos grupos distintos. En uno se encontraron los aislados consistentes con CM
haemominutum y en el otro, los aislados consistentes con M haemofelis. Este estudio
reportó además, sobre la existencia de un patógeno hemotrópico con una secuencia del gen
16S ARNr, casi idéntica a las descritas en Estados Unidos, en perros y gatos de Alemania,
Reino Unido, Francia, Australia, Sudáfrica e Israel (Tasker et al., 2003a), a pesar de
encontrar grandes diferencias porcentuales entre las secuencias de nucleótidos aisladas, que
generan en el autor inquietud sobre los criterios de definición de nuevas especies de
hemoplasma.
En el 2005, se descubrió una tercera especie de hemoplasma felino aislada desde
una muestra de sangre obtenida de un gato con signos clínicos de una severa anemia
hemolítica en Suiza, que luego fue nombrada: “Candidatus Mycoplasma turicensis” (CM
turicensis) (Willi et al., 2005). Posteriormente, en 2006, este agente fue aislado desde
muestras de sangre de gatos de tres continentes distintos (Europa, Australia y África),
demostrando que la infección con CM turicensis en gatos existe en una amplia área
geográfica (Willi et al., 2006b).
7
3.5 Estudios complementarios.
3.5.1. Efecto clínico.
Siendo el PCR un medio de diagnóstico de alta sensibilidad y especificidad (Tasker
et al., 2003b), da la certeza necesaria en el reconocimiento del agente y facilita la
investigación sobre las distintas características del organismo y de la enfermedad. Además,
permite distinguir en forma confiable entre las distintas especies de hemoplasma y así,
especificar cuál está presente en cada muestra y si la infección es simple (de una especie) o
mixta (coinfección) (Tasker et al., 2003b). Esto ha permitido estudiar el efecto patológico
de cada especie, ya que se sabe que los hemoplasmas causan un gran rango de cuadros
clínicos, desde asintomáticos a severos y posiblemente fatales. En los felinos, la infección
aguda está asociada a una parasitemia masiva de M haemofelis. Los gatos infectados
presentan anemia hemolítica severa y las principales manifestaciones clínicas son
taquipnea, letargia, depresión, anorexia, mucosas pálidas, ictericia, emaciación,
deshidratación y esplenomegalia (Harrus et al., 2002). En cambio, una infección con CM
haemominutum en animal sano sólo genera leves signos clínicos. La infección crónica con
hemoplasma se caracteriza por bajo o indetectable número de parásitos en los frotis
sanguíneos (independiente a su especie) y por signos de anemia leve o un cuadro
asintomático. Además, existe un estado de portador en los gatos que se recuperan de la
enfermedad aguda, incluso cuando se realiza un tratamiento antibiótico efectivo (Messick,
2004).
En el caso de una infección natural con CM turicensis, Willi et al. (2006a)
describieron una carga parasitaria sanguínea significativamente más baja que la encontrada
con M haemofelis y CM haemominutum y no encontraron una correlación entre la infección
y un bajo volumen globular aglomerado (VGA). En cambio, una transmisión experimental
de CM turicensis a gatos libres de patógenos, resultó en el desarrollo de anemia moderada a
marcada en todos ellos. Anemia más severa y una mayor bacteremia fueron observadas en
un gato que fue previamente inmunocomprometido a través de la administración de
corticoesteroides. El potencial patógeno de esta especie, parece depender de cofactores
tales como inmunosupresión o coinfección con otros hemoplasmas (Willi et al., 2007).
A través del PCR se ha reconocido la existencia de casos de coinfección, con dos e
incluso tres especies de hemoplasma, generándose un efecto aditivo y cuadros clínicos más
8
severos. La existencia de la coinfección, sugiere al menos tres alternativas: que no existe
una protección inmunológica cruzada entre las distintas especies, que tienen similares rutas
de transmisión o que la infección con una especie, aumenta la susceptibilidad a las otras
especies (Willi et al., 2006b).
3.5.2. Prevalencia.
La prevalencia de la infección muestra mucha variación entre los distintos estudios.
Así, en el Reino Unido varió entre 5,15 a 42% cuando el diagnóstico se realizó por
observación directa (Tasker et al., 2003b). Sin embargo, los resultados también son
variados al estudiarla mediante ensayo de PCR. Algunas prevalencias publicadas son las
siguientes; En Estados Unidos en 2001 se reportó un 19,5%, en Reino Unido en 2003 un
18,5% (Tasker et al., 2003b), mientras Willi et al., 2005 reportaron un 8,5 % en Suiza.
Estas diferencias sugieren que pueden existir variaciones geográficas en la prevalencia de
las distintas especies de hemoplasma (Tasker et al., 2003b). Además, Willi et al., (2006b)
al comparar las prevalencias de Sudáfrica, Reino Unido, Australia y distintas regiones de
Suiza, encontraron mayores prevalencias en países con climas más cálidos, sugiriendo que
los artrópodos hematófagos presentes pueden tener un importante rol en la transmisión de
hemoplasma, existiendo un mayor número o distintas variedades de ellos en estos climas.
Un estudio reciente realizado en Brasil, en que se investigó la prevalencia y los
factores de riesgo de la infección, utilizó PCR especifico para M haemofelis y CM
haemominutum en gatos, los que también fueron probados para la presencia del virus de la
inmunodeficiencia felina (VIF) y el virus de la leucemia felina (ViLeF) mediante un ELISA
comercial.
Este estudio reflejó prevalencias de 4,0, 2,6, 12,5 y 7,8% de M haemofelis y de 32,
5,1, 50 y 5,2% de CM haemominutum en grupos de gatos positivos a VIF, positivos a
ViLeF, positivos a VIF y ViLeF y negativos a VIF y ViLeF, respectivamente (Macieira et
al., 2007).
3.5.3. Factores de riesgo.
Numerosos estudios buscan demostrar los factores de riesgo de la infección con
hemoplasma. En un análisis multivariable realizado por Tasker et al., (2003b), aun cuando
9
en estudios previos determinaron que los gatos jóvenes tenían mayor predisposición a la
infección, demostró que gatos de mayor edad presentan mayor prevalencia de hemoplasma.
Esto puede ser explicado por una mayor exposición al agente a medida que pasa el tiempo,
además de que no ocurre una eliminación completa del Mycoplasma hemotrópico luego de
la recuperación y, por lo tanto, el gato se mantiene positivo. La edad se considera como un
factor de confusión porque los animales jóvenes son significativamente más sanos y se sabe
que el estado de salud es un factor de riesgo, ya que el estrés, la inmunosupresión y las
enfermedades concomitantes desencadenan la infección con hemoplasma y la presentación
de signos clínicos. Al comparar gatos mestizos con los de razas finas, los autores no
encontraron diferencias significativas. Algunos estudios postulan que no existe
predisposición por sexo, sin embargo, se encontró una mayor prevalencia en los gatos
machos. Otro factor importante es el clima y la presencia de artrópodos hematófagos,
siendo estos vectores mecánicos y responsables de la transmisión indirecta, considerada
como el principal medio de transporte del agente entre los gatos (Willi et al., 2006a).
3.5.4. Asociación con enfermedades retrovirales.
Las infecciones con hemoplasmas raramente causan una enfermedad fulminante en
un hospedero sano. Se relacionan más frecuentemente con enfermedades de curso crónico
con gran variedad de signos clínicos. De hecho, en el pasado, los Mycoplasmas se
consideraban como "parásitos ideales" por vivir en armonía relativa con sus hospederos.
Sin embargo, la asociación de una infección latente de hemoplasma con una enfermedad,
tanto en animales sanos como en inmunocomprometidos está emergiendo últimamente.
En los felinos, a pesar de que M haemofelis causa una enfermedad primaria, también
es común reconocerlo como un patógeno que actúa en conjunto con los agentes retrovirales,
incluyendo VIF y ViLeF, así como con otras enfermedades debilitantes.
En un estudio realizado en Brasil se demostró que gatos portadores de VIF y
portadores de ambos VIF y ViLeF, se encontraron en un riesgo mayor de estar infectados
con hemoplasmas que los gatos con estatus retroviral negativo, principalmente debido a
infección con CM haemominutum (Macieira et al., 2007).
En el caso de una infección experimental, gatos infectados con ViLeF y CM
haemominutum, desarrollaron una anemia más severa que gatos infectados solo con el
10
parásito (Messick, 2004). La infección con ViLeF se ha demostrado como un factor de
riesgo de la Anemia Infecciosa Felina, ya que al generar inmunosupresión contribuye a la
infección con hemoplasma e induce la presentación de signos clínicos, que además son más
severos que en una infección causada únicamente por hemoplasma. Harrus et al., (2002),
no encontraron diferencias hematológicas o clínicas significativas entre gatos con estatus de
VIF negativo y VIF positivo, pero los últimos demostraron tendencia a una reducida
sobrevivencia.
3.5.5. Transmisión y reservorios.
Las rutas de transmisión de los hemoplasmas son aún pobremente comprendidas. La
transmisión experimental por las vías intravenosa, intraperitoneal y oral, utilizando sangre
infectada se ha demostrado exitosa. También ha sido reportada la transmisión iatrogénica
por transfusión sanguínea (Willi et al. 2007).
Los artrópodos hematófagos han sido propuestos como el medio natural de la
transmisión del agente entre gatos. ADN de CM haemominutum y de M haemofelis han
sido detectados en pulgas (Ctenocephalides felis) colectadas desde gatos y en heces de
pulgas, pero el intento de transmitir M haemofelis y CM haemominutum entre gatos, a
través de la actividad hematófaga de C. Felis, no fue concluyente (Willi et al. 2007).
Existe una creciente evidencia de transmisión directa de hemoplasma entre gatos. Se
ha logrado detectar ADN de hemoplasma en la saliva de animales infectados y la
asociación de la infección de hemoplasma con el género masculino, acceso a la calle y la
presencia de abscesos luego de mordeduras de gatos, apoya esta teoría. Se cree que la
conducta agresiva, más que el uso compartido de utensilios de comida, es necesaria para la
transmisión directa de hemoplasma (Willi et al., 2006a y 2007).
11
4. OBJETIVO GENERAL
Determinar la presencia y la identidad de Mycoplasma hemotrópico en sangre de
gatos en Israel.
OBJETIVOS ESPECIFICOS.
1. Estimar el número de gatos positivos a Mycoplasma hemotrópico.
2. Revelar la identidad de las especies de Mycoplasma hemotrópico presentes en
Israel.
3. Comparar la prevalencia de Mycoplasma hemotrópico y de cada especie de
Mycoplasma hemotrópico en gatos de distintas poblaciones.
12
5. MATERIALES Y METODOS
5.1. Colección de muestras sanguíneas.
Las muestras de sangre fueron colectadas en tubos de ensayo con EDTA, desde 55
gatos provenientes de diferentes lugares de Israel, 29 de los cuales correspondieron a
individuos enfermos admitidos en el Hospital Veterinario de la Escuela de Veterinaria (Bet
Dagan) de la Universidad Hebrea de Jerusalén y a gatos descartados de la lista de donantes
del banco de sangre, que fueron elegidos tras resultar positivos a VIF por un ensayo
serológico (ELISA). Los 26 gatos restantes fueron individuos alojados en una gatería de
una sociedad protectora, en la cuidad de Tel Aviv (”Tzaar Baalei Jaim”). Se recolectó toda
la información disponible sobre cada gato: identificación (género, edad y raza), localización
y estado de salud (presencia de signos clínicos y volumen globular aglomerado (VGA)).
5.2. Extracción de ADN.
Se utilizó el método de fenol-cloroformo para la extracción del ADN desde las
muestras de sangre entera, adaptando el protocolo descrito por Gal et al., (2007), que se
explica a continuación: las muestras fueron homogeneizadas y el ADN fue extraído desde
100 IL de sangre mediante la agregación de 300 IL de tampón lítico (50 mM NaCl
(Sigma®)), 50 mM Tris (Sigma®), 10 mM EDTA [pH = 8,0] (Sigma®)), proteinasa K (GE
healthcare®) en una concentración final de 250 Ig/mL y Triton X-100 (20%) (Sigma®) en
una concentración final de 1%. Después de 2 h de incubación a 56º C y la inactivación de la
proteinasa K en 90º C por 10 min, se agregaron 300 IL de una mezcla de fenol (Sigma®)
(75%), cloroformo (Sigma®) (24%) e isoamilalcohol (Sigma®) (1%) que luego fue
mezclada y centrifugada (12,000 xg) por 3 min. Se colectó el sobrenadante y fueron
agregados 300 IL de una mezcla de fenol (50%), cloroformo (48%) e isoamilalcohol (2%)
que luego fue mezclada y centrifugada (12.000 xg) por 3 min. El sobrenadante fue
colectado y se agregaron 300 IL de una mezcla de cloroformo (96%) e isoamilalcohol
(4%), que nuevamente fue mezclada y centrifugada (12.000 xg) por 3 min. El sobrenadante
fue colectado y se agregó un volumen (1:10) de acetato de Na (WWR international Ltd. ®)
(3 M) y luego un volumen de isopropanol (100%) (Sigma®) (a -20º C). La mezcla fue
incubada durante la noche a -20º C. Se realizó una centrifugación (14.000 xg) a 4º C por 30
13
min, el sobrenadante fue descartado, el pellet fue lavado con 150 IL de etanol (Bio Lab,
Ltda. ®) (75%, -20º C) y centrifugado (13.000 xg) por 15 min. El sobrenadante se descartó
nuevamente y el pellet se dejó secar. El ADN fue resuspendido con 30 IL de H2O
desionizada y destilada durante 1 h a 37º C.
En cada sesión de extracción de ADN, fue incluida una muestra de control negativo
que no incluía sangre (el volumen correspondiente (100 μL) fue sustituido con H2O
destilada), para permitir la detección de una contaminación en caso que la hubiera.
Finalizada cada sesión de extracción, la concentración de ADN en los productos de
todas las muestras fue evaluada mediante el uso de un espectrofotómetro (WPA UV1101
Biotechphotometer®) que sirvió para medir, en función de la longitud de onda, la
relación entre valores de una misma magnitud fotométrica, relativos a dos haces de
radiaciones (260 y 280 ). Al proyectar un haz de luz monocromática a través de una
muestra y medir la cantidad de luz que es absorbida, se registra la información sobre la
naturaleza de la sustancia en la muestra (pureza) y se indica la cantidad de la sustancia
presente.
5.3. Ensayo de PCR.
5.3.1. Ensayo de PCR para Mycoplasma hemotrópico.
Al ser esta investigación la primera de utilizar el método molecular de PCR para la
detección de hemoplasma que se realiza en Israel, se decidió utilizar partidores universales
para el género Mycoplasma, descritos a continuación: Directo =
ACGAAAGTCTGATGGAGCAATA (posiciones 352 a 373 en #U95297); Reverso =
ACGCCCAATAAATCCG(A/G)ATAAT (posiciones 544 a 523) (Metabion/ IDT),
diseñados específicamente para amplificar el gen 16S ARNr por Jensen et al. en 2000.
Estos partidores fueron elegidos por falta de conocimientos previos sobre las
variedades de hemoplasma presentes en la población de gatos en Israel y su uso permitió la
formación de un producto (amplicón) para cualquier variedad de hemoplasma que se
presentase en las muestras sanguíneas. Cada amplicón producido por estos partidores, fue
secuenciado y comparado con las especies de hemoplasma previamente conocidas y de esta
manera, fueron identificados.
14
Mezcla de reacción.
La amplificación del ADN fue realizada en una mezcla de reacción de volumen total
de 25 IL, compuesta por: 50 ng de ADN templado (5 μL), 12,5 IL de una mezcla
industrial para PCR (X2 Taq Master Mix purple, Lamda biotech®) que contiene: 10mM
KCl, 20mM (NH4)2SO4, 0,1% Triton X-100, 1,5mM MgCl2, 200 IL dNTP, 1,5
unidades/50IL de Taq ADN polimerasa, trazas de marcador rojo y azul y estabilizadores de
enzimas. Además, se adicionaron 1,5 IL de Cl2Mg en 50mM (EURx®) y 10 pmoles de
cada partidor.
Protocolo de termociclación.
El protocolo de termociclación utilizado fue el siguiente: 10 min de incubación a
20° C seguidos por 2 min de desnaturación a 95° C, luego 45 ciclos de 1 min de
desnaturalización a 95° C, 1 min de apareamiento a 60° C y 30 seg de extensión a 72° C
(Jensen et al., 2000). El procedimiento fue realizado en un termociclador T1 de Biometra
®.
Muestras de control.
En los ensayos de PCR fue incluido ADN de muestras de control positivo de cada
una de las especies conocidas de Mycoplasma hemotrópica, obtenidas desde gatos positivos
y comprobados en PCR en tiempo real en la Universidad de Bristol, Inglaterra
(generosamente enviadas por Dra. Severine Tasker), que luego fueron sometidos a PCR y
sus productos fueron secuenciados para obtener una referencia. Además, se utilizó como
controles negativos tubos de ensayo con la mezcla de reactivos excluyendo el ADN. El uso
de los tubos de control positivo y negativo es fundamental para asegurar la pureza del
proceso y su adecuado funcionamiento técnico.
5.3.2. Ensayo de PCR para VIF.
Para conocer el estatus de VIF de los gatos participantes de este estudio, la
existencia de ADN del VIF fue determinada mediante un ensayo de PCR. Las secuencias
de bases de los partidores y los protocolos de termociclación fueron entregados como una
comunicación personal por la Dra. Gila Bar Gil, que los diseñó y utilizó en estudios aún no
15
publicados. Los partidores fueron específicos para la detección de los segmentos de la
proteína GAG y del gen ENVELOPE del virus cuyo tamaño molecular es de 500 bp cada
uno.
Todos los pasos previos y posteriores a la termociclación fueron similares a los
realizados y descritos para Mycoplasma hemotrópico.
5.4. Separación de los productos.
Todos los productos amplificados en PCR fueron separados según su tamaño
molecular mediante Electroforesis. Las condiciones especificas del procedimiento fueron
las siguientes: Se prepararon geles de agar (SeaKem®) en concentración de 3,5% en una
solución tampón Tris HCl-EDTA (Frutarom LTD®, Sigma®, Sigma® respectivamente)
teñidos con bromuro de etidio (1mg/ml, HyLabs). Cada gel fue cargado con un marcador de
ADN (Bioneer® 25/100bp escala de peso molecular) y con los productos de PCR para ser
sometido a la electroforesis por 45 minutos a una potencia de 90 V y 500 A. La
visualización de las bandas resultantes se realizó en una cámara oscura de iluminación ultra
violeta en la que se tomaron fotografías digitales presentadas y analizadas mediante un
programa computarizado (Kodak® 1D 3.6). Las bandas de interés fueron seccionadas y
guardadas en tubos de ensayo etiquetados.
5.5. Purificación de los productos.
Las bandas seccionadas fueron procesadas en el “Ultraclean 15 Purification Kit”
(MoBioLaboratories, inc. ®) de acuerdo al siguiente protocolo:
Cada tubo de ensayo a utilizar se pesó previa y posteriormente a la agregación del
trozo de gel de agar que contenía el ADN a purificar. Se agregaron tres volúmenes de la
solución "ULTRA SALT" (sal caotrópica) (por ejemplo, 0,3 ml de “ULTRA SALT” sobre
0,1 gr de gel). Se agitó y se incubó en 55° C por 5 min mezclando hasta que el gel se
derritió completamente. En esta etapa los enlaces hidrogenados del gel se rompieron
irreversiblemente. Se agregaron 6 μL de la solución de "ULTRA BIND" (Sílice) y se
incubó por 5 min a temperatura del ambiente mezclando suavemente. El ADN se enlazó
con el sílice de la solución en la presencia de la sal caotrópica. Se centrifugó por 1 min y se
colectó el sobrenadante separando el ADN unido al sílice de los restos de agar y la
16
"ULTRA SALT". El pellet se resuspendió por un minuto en la solución de "ULTRA
WASH" (Etanol 50% y solución tampón), se agitó por 10 seg y se colectó el sobrenadante.
Esto se repitió dos veces para lograr desechar toda la solución. El ADN se purificó
manteniendo su unión al sílice. El pellet se resuspendió en 12 μL de H2O estéril,
rompiendo el pellet mediante una punta de pipeta y agitando la solución manualmente. Se
incubó por 5 min a temperatura del ambiente, el ADN se separó del sílice irreversiblemente
y mediante 1 min de centrifugación se formó un pellet de sílice. Se aspiró el sobrenadante y
se conservó como producto final de ADN. Se determinó la concentración de ADN en la
solución final mediante espectrofotometría.
5.6. Secuenciación de los productos.
Este proceso fue realizado en el “Centro de Tecnologías Genéticas” de la
Universidad Hebrea de Jerusalén, al cual se envió ADN de cada producto extraído desde el
gel diluido a concentración de 20-50 ng/IL. La tecnología utilizada fue el “BigDye
Terminator Cycle Sequencing chemistry" de “Applied Biosistems” (ABI), "ABI 3700 DNA
analyzer" y el "ABI's Data collection and Sequence Analysis software".
En el proceso, el ADN fue químicamente etiquetado con marcadores fluorescentes
y luego se realizó una electroforesis en capilares finos con cristales de sílice. A
continuación, el ADN pasó por una célula de detección con luz de láser, la que generó
fluorescencia que fue detectada por una cámara, transformando la imagen generada en
información por una estación computacional que la analizó y presentó como una secuencia
de bases y un electroferograma. (Anexo Nº1).
5.7. Alineamiento e identificación de las secuencias de ADN.
La identificación de la secuencias se realizó mediante el programa de computación
llamado "Sequence scanner software V.1.”, que permite abrir, analizar, editar y almacenar
las secuencias obtenidas en el ABI, preparando la información para ser comparada con las
secuencias disponibles en el banco genético (http://www.ncbi.nlm.nih.gov/blast/)
utilizando el “Basic Local Alignment Search Tool” (BLAST). Este programa reconoce
regiones de similitud entre secuencias mediante la comparación de secuencias de
nucleótidos o proteínas, con las secuencias existentes en la base de datos y calcula la
importancia estadística de esa similitud.
5.8. Prueba serológica de ViLeF.
La prueba serológica de ViLeF fue realizada mediante un kit comercial
(SNAP FIV/FeLV combo, IDEXX Laboratories) que utiliza ELISA para la detección
de la presencia de antígenos del virus en sangre, suero o plasma del gato examinado. El
protocolo del ensayo es el siguiente: se mezclan 3 gotas de muestra (sangre, suero o
plasma) con 4 gotas del reactivo conjugado en un tubo, se agrega en la ventana de
aplicación de muestra en el aparato. Cuando una coloración azul aparece en el
de activación, se presiona el aparato para lograr su nivelación. Se esperan 10 min
para ver el resultado del ensayo. La interpreta
ubicación de los círculos azules que aparecen, pudiendo detectar la presencia de
antígenos de ViLeF y de anticuerpos contra VIF, como se describe en la figura Nº 1.
Figura Nº 1. Interpretación de los resultados del
ensayo de ViLeF/ VIF.
5.9. Análisis estadístico.
Un objetivo determinado en este ensayo, fue la
Mycoplasma hemotrópico y sus especies, en los diferentes segmentos de la
gatos. Para lograrlo los resultados fueron comparados mediante la prueba estadística de Chi
cuadrado (X2), mediante el programa computacional
17
(Anexo Nº1).
n interpretación del ensayo depende del nú
(Obtenido del sitio web de IDEXX Laboratories
comparación de las prevalencias de
), SPSS. Esta prueba permite analizar si
círculo
minutos
ción número y la
)
población de los
18
las diferencias en el número de variables categóricas existentes en distintos grupos, se debe
realmente a la pertenencia en el grupo o del azar. Todas las comparaciones se realizaron en
tablas de 2 filas por 2 columnas y por lo tanto el grado de libertad (GL) fue siempre igual a
1. El nivel de significancia predeterminado fue el de 0,05 (5%), determinando el nivel de
probabilidad. En todas las comparaciones, la hipótesis nula (H0) es que las diferencias
encontradas son independientes al grupo y la H1 es que las diferencias encontradas son
asociadas a la pertenencia a grupos distintos.
La prueba de X2 permitió además comparar la composición demográfica de los
grupos formados para caracterizarlos y comprobar que se diferencian entre sí, entregando
los valores de Riesgo Relativo (RR) y los intervalos de confianza 95% (CI 95%) de
pertenecer a cada categoría en las subpoblaciones analizadas.
La prueba de X2 fue utilizada nuevamente al comparar los resultados obtenidos en
este ensayo con los publicados en la literatura (resultado obtenido versus esperado),
definiendo si las diferencias encontradas tienen validez estadística (ver discusión).
6. RESULTADOS
6.1. Composición de la población general de gatos.
Los 55 ejemplares muestreados formaron el grupo llamado “Población general de
gatos” y toda la información accesible fue recolectada, archivada y es presentada en la
tabla Nº 1. A continuación, se realizó una segmentación según las variadas características y
una agrupación en distintos subgrupos y subpoblaciones que serán analizados
individualmente y comparadamente en este trabajo.
Tabla Nº 1. Muestras y datos recolectados de los gatos.
Nº de
serie
Nº de
Muestra
Origen
Muestra
Edad Género Domicilio Estado clínico
1 1018 H.V 4a M Ramat Gan Eutanasiado
2 4230 B.S N/I M Lod Sano
3 1456 H.V 1.5a M Rehovot Problemas dentales (HTC 22%)
4 1692 H.V 8a M Tel Aviv
Apatía, anorexia, periuria, shock
(HTC 9.67%)
5 1832 H.V 10a M Reut
Letargia, apatía, anorexia
(HTC 28%)
6 3916 B.S N/I M Lod Sano
7 4180 B.S N/I M Volcani Inst. Sano
19
8 5066 B.S N/I M Volcani inst Sano
9 5141 B.S N/I M Lod Sano
10 7174 B.S N/I M Rishon Letzion Sano
11 0068 H.V 8a M Nes Tziona Problemas bucales, anorexia
12 7618 H.V 1a M Kiriat Tivon
Opacidad corneal, glaucoma
(HTC 40.8)
13 219 H.V 5a M N/I N/I
14 234 H.V N/I N/I N/I N/I
15 80293793 H.V N/I N/I N/I N/I
16 60049 H.V N/I N/I N/I N/I
17 9774 H.V 7.5a F Tel Aviv
IRC, apatía, anorexia, depresión,
Buena condición física, anemia (HTC
14.8%)
18 1019 H.V 12a M Nes Tziona Sano
19 3991 H.V 5a M Ramat Gan ,Depresión, anorexia, FLUDT
20 1028 B.S N/I N/I Sano
21 9949 B.S N/I M Volcani Inst. Sano
22 1104 H.V 4a M Bet Dagan
Hiporexia, apatía, vómitos, palidez de
membranas (HTC 33%)
23 3625 H.V 6m M Rehovot
Atropello, trauma espinal,
(HTC 41%)
24 4050 H.V N/I N/I N/I N/I
25 61939 H.V N/I N/I N/I N/I
26 9530 H.V N/I N/I N/I N/I
27 60041 H.V N/I M N/I N/I
28 43866 H.V 17a F N/I N/I
29 0063 H.V 10a M N/I
Atropello, Gingivitis, anorexia,
micción forzada, (HTC 31.8%)
30 070504-04 S.P 6m M Tel Aviv N/I
31 070517-07 S.P 3a F Tel Aviv N/I
32 070517-08 S.P 6m F Tel Aviv N/I
33 070525-03 S.P 8m F Tel Aviv N/I
34 070601-01 S.P 4m F Tel Aviv N/I
35 070608-02 S.P 8m F Tel Aviv N/I
36 070628-02 S.P 1a F Tel Aviv N/I
37 070517-10 S.P 2m M Tel Aviv N/I
38 070504-05 S.P 6m M Tel Aviv N/I
39 070608-01 S.P 4m F Tel Aviv N/I
40 070601-05 S.P 4m F Tel Aviv N/I
41 070601-07 S.P 1a F Tel Aviv N/I
42 070525-02 S.P 3a M Tel Aviv N/I
43 070608-04 S.P 4m F Tel Aviv N/I
44 070621-04 S.P 2m M Tel Aviv N/I
45 070628-01 S.P 3a F Tel Aviv N/I
46 070628-03 S.P 6m F Tel Aviv N/I
47 070628-05 S.P 6m M Tel Aviv N/I
48 070628-06 S.P 4m M Tel Aviv N/I
49 070621-01 S.P 5m F Tel Aviv N/I
50 070621-02 S.P 3m F Tel Aviv N/I
51 070621-05 S.P 2m F Tel Aviv N/I
20
52 070608-03 S.P 4m M Tel Aviv N/I
53 070601-03 S.P 4m F Tel Aviv N/I
54 070601-02 S.P 4m M Tel Aviv N/I
55 070601-06 S.P 2a F Tel Aviv N/I
H.V- Hospital Veterinario, B.S- Banco de Sangre, S.P- Sociedad Protectora, a- año, m- meses,
M- masculino, F- femenino, N/I- no hay información.
6.2 Análisis demográfico de la población general de los gatos y segmentación en
subgrupos y subpoblaciones.
La información recolectada sobre los gatos, principalmente la edad y el género, fue
analizada en la población general de los gatos. Se calculó una edad promedio de 3 años y 8
meses de vida y una mayor participación de gatos machos (60,41%). Para lograr un análisis
más detallado, la población general de los gatos fue segmentada en subpoblaciones y en
subgrupos (tabla Nº 3). Los gatos fueron divididos en las subpoblaciones 1 y 2 de acuerdo a
sus orígenes. La subpoblación 1 (n=29) incluyó a los gatos provenientes del Hospital
Veterinario o del Banco de Sangre (gatos Nº serie 1-29 en la tabla Nº 1) seleccionados por
positividad serológica a VIF, resultando un grupo con un promedio de edad de 6,5 años y
con 91% de gatos machos. Al dividir esta subpoblación en categorías de edad, el 92,3%
fueron mayores que un año de vida. Además, se encontraron prevalencias de 96,5% (28/29)
de VIF mediante PCR y de 35,7% de ViLeF mediante una prueba serológica en esta
subpoblación. La subpoblación 2 (n=26), incluyó a los gatos callejeros alojados en una
gatería de la sociedad protectora de animales (gatos Nº serie 30-55 en tabla Nº 1). En esta
subpoblación, la división en categorías de edad demostró un 23% de gatos mayores que un
año de vida (con promedio de 9 meses) y solo un 34,6% de los gatos fueron machos.
Además, se encontraron prevalencias de 11,5% de VIF (3/26) y de 58% de ViLeF (15/26).
La diferencia en prevalencia de gatos machos entre las dos subpoblaciones de origen, fue
examinada mediante la prueba de Chi cuadrado y generó un resultado de P<0,001
determinando que existe una diferencia significativa en la participación de machos y
hembras en las dos subpoblaciones, habiendo un riesgo mayor de ser macho en la
subpoblación 1 que en la subpoblación 2 (RR=2,626; CI95%=1,52-4,353). La diferencia en
la división en categorías de edad se encontró un riesgo relativo de ser mayor que un año 4
21
veces mayor al pertenecer a la subpoblación 1 en relación a la subpoblación 2 (RR=4,0;
CI95%=1,95-8,21), una diferencia altamente significativa en la composición de las
subpoblaciones (P<0,001).
La población general fue dividida además en subgrupos de acuerdo a la edad y el
género de los gatos. La división en dos subgrupos según la categoría de la edad se encontró
necesaria debido al gran rango de edad de los gatos muestreados, incluyendo gatos desde 2
meses de vida hasta un gato de 17 años (tabla Nº 2 y gráfico Nº 1). El criterio de la división
fue la edad de un año de vida (incluyendo los gatos de un año con los gatos mayores a un
año), logrando así una comparación entre los gatos adultos (n=18) y los gatos jóvenes
(n=21). Los subgrupos divididos según el género de los gatos, se formaron tomando en
cuenta solamente los gatos de género conocido, formando un grupo de machos (n=29) y
otro de hembras (n=19).
Tabla Nº 2. Distribución de la edad de los gatos en la población general.
Edad en años Nº de gatos
0,16 3
0,25 1
0,3 8
0,4 1
0,5 6
0,6 2
1 4
2 1
3 3
4 2
5 2
7,5 1
8 1
10 2
12 1
17 1
22
Gráfico Nº 1.
Posteriormente, la población general fue segmentada en subpoblaciones de acuerdo
a los resultados del ensayo de PCR para VIF y la prueba serológica de ViLeF: la
subpoblación VIF positivo (n=31) fue compuesta por 87,5% de gatos mayores de un año de
edad, con un promedio de 5,4 años y 83,3% de machos en comparación a la subpoblación
VIF negativo (n=24) con un promedio de edad de 9 meses (17,4% mayores que un año) y
37,5% de machos. Estos valores fueron comparados y se encontró una diferencia
significativa en la categoría de edad (porcentaje de gatos adultos) entre ambas
subpoblaciones (P<0,001) y una diferencia significativa en la prevalencia de machos y
hembras en los distintos grupos (P=0,001). Se entiende que el riesgo relativo de ser gato
macho (RR=2,222; CI95% 1,29-3,84) y de ser gato adulto (RR=5,031; CI95%=2,03-12,5)
es mayor en la subpoblación VIF positivo que en la VIF negativo.
Otras subpoblaciones se definieron de acuerdo al estado de ViLeF. La subpoblación
ViLeF positivo (n=25), con 27,8% de gatos mayores que un año de vida y un promedio de
edad de 1,48 años y 60% de machos, en comparación con la subpoblación ViLeF negativo
(n=29) con 60% de gatos adultos, con un promedio de edad de 2,8 años y 63% de machos,
siendo la diferencia de categoría de edad significativa (P=0,046) y la diferencia de géneros
no significativa (P=0,836). Se entiende que el riesgo relativo de ser gato joven es mayor en
la subpoblación ViLeF positivo que en la ViLeF negativo (RR=1,8; CI95%=0,98-3,32).
Finalmente, se dividió la población general por el estado retroviral (RV),
considerando un estado retroviral positivo al presentar al menos uno de los dos agentes
0
1
2
3
4
5
6
7
8
9
0,160,250,30,40,50,6 1 2 3 4 5 7,5 8 10 12 17
Nº de gatos
Edad
Distribución de la edad de los gatos en la
población general
23
retrovirales estudiados (VIF y ViLeF) y comparándolos con los gatos de estado retroviral
negativo. En la subpoblación de estado retroviral positivo (n=45 gatos del total de 55
gatos), se encontró 51,7% de gatos mayores de un año, con un promedio de edad de 3,26
años y 71,1% de machos y en la subpoblación de estado retroviral negativo (n=10), el 30%
fueron mayores que un año, con promedio de edad de 1,08 años y el 20% de machos. La
diferencia de categoría de edad no se encontró significativa (P=0,235) y el porcentaje de
machos si lo fue (P=0,003; RR=3,553; CI95%=1,01-12,48).
Tabla Nº 3. Estudio demográfico de los grupos segmentados.
*P<0,001; “P<0,001; **P=0,003; +P=0,001; ++P= 0,046; “”P<0,001
6.3. Extracción de ADN desde las muestras sanguíneas.
En la tabla Nº 4, se presentan los resultados de la extracción de ADN desde las
muestras sanguíneas. Las primeras columnas (“260 ” y “280 ”), entregan los resultados de
las mediciones de la absorción lumínica detectada en estas dos longitudes de onda. La
relación entre ambas (260/280), representa el grado de pureza del ADN obtenido, pudiendo
detectar la presencia de residuos de distinta naturaleza, resultantes de la destrucción celular
realizada durante el proceso de extracción, que podrían influenciar el proceso de PCR y la
siguiente secuenciación. Productos de extracción que arrojaron un valor en la relación de
260/280 igual o mayor a 1,3 se aceptaron y en los de valores inferiores, la extracción se
repitió. Excepcionalmente se aceptó un valor inferior a 1,3 si la muestra de sangre fue
Población
Género
(%)
Categoría de edad
(%) Promedio de
edad (años)
Total
(N)
Machos Hembras año
Todos los gatos 60,41 39,59 53,8 46,2 3,65 55
Origen 1 90,9* 9,1 7,7 92,3”” 6,5 29
Origen 2 34,6* 65,4 77,0 23,0”” 0,8 26
Machos 100,0 0,0 45,0 55,0 3,31 29
Hembras 0,0 100,0 63,16 36,84 2,06 19
Edad < 1año 42,86 57,14 100,0 0,0 0,38 21
Edad > 1año 61,1 38,8 0,0 100,0 5,13 18
RV + 71,1** 28,94 48,27 51,42 3,26 45
RV - 20,0** 80,0 70,0 30,0 1,08 10
VIF+ 83,3+ 16,6 12,5 87,5” 5,4 31
VIF - 37,5+ 62,5 82,6 17,4” 0,8 24
ViLeF+ 60,0 40,0 72,2++ 27,8 1,48 25
ViLeF - 62,96 37,03 40,0++ 60,0 2,8 29
VIF + ViLeF+ 83,0 17,0 20,0 80,0 4,46 11
24
escasa o cuando dos ensayos de extracción arrojaron resultados similares. Además, se
presenta la concentración obtenida de ADN que permitió calcular la dilución necesaria del
ADN para la preparación de los productos con concentración de 10 ng/μL y volumen (5
μL) uniformes en el PCR. Las dos últimas columnas demuestran los volúmenes de
productos de extracción (ADN) y de agua destilada utilizados en la dilución.
Tabla Nº 4. Resultados de la extracción de ADN.
Identificación
Evaluación del producto
de extracción
Dilución a concentración
final de 10 ng/μL en 25 μL.
Nº de serie Nº Muestra 260 280 280/260
Concentración
de ADN (ng/LL)
Volumen de
ADN (LL)
Volumen de
H2O (LL)
1 1018 0,69 0,392 1,76 34,5 7,24 17,75
2 4230 0,84 0,67 1,25 42,1 5,93 19,06
3 1456 1,43 1,07 1,33 71,5 3,49 21,50
4 1692 1,006 0,86 1,16 50,3 4,97 20,02
5 1832 1,23 0,88 1,40 61,8 4,04 20,95
6 3916 0,332 0,159 2,09 16,6 15,06 9,93
7 4180 0,341 0,165 2,07 17,1 14,61 10,38
8 5066 0,817 0,427 1,91 40,8 6,12 18,87
9 5141 0,926 0,517 1,91 46,3 5,39 19,60
10 7174 0,495 0,245 1,79 46,3 5,39 19,60
11 0068 1,265 0,848 1,49 63,2 3,95 21,04
12 7618 0,461 0,318 1,45 23,0 10,86 14,13
13 219 3,005 4,932 1,60 246,6 1,70 23,29
14 234 2,051 1,210 1,69 102,6 2,43 22,56
15 80293793 6,260 3,581 1,75 313,0 0,79 24,20
16 60049 0,29 0,19 1,47 14,6 17,12 7,87
17 9774 0,937 0,664 1,41 46,8 5,34 19,65
18 1019 0,805 0,625 1,30 40,3 6,20 18,79
19 3991 0,49 0,39 1,26 24,8 10,08 14,91
20 1028 0,61 0,46 1,32 30,6 8,16 16,83
21 9949 0,47 0,36 1,30 23,9 10,46 14,53
22 1104 1,0 0,76 1,30 50,0 5,00 20,00
23 3625 0,162 0,095 1,70 8,1 25,00 0
24 4050 0,668 0,411 1,63 33,4 7,48 17,51
25 61939 2,20 1,37 1,60 110,3 2,26 22,73
26 9530 1,06 1,68 1,56 53,3 4,69 20,30
27 60041 1,755 1,219 1,44 87,8 2,84 22,15
28 43866 0,61 0,26 1,41 18,8 13,29 11,70
29 0063 0,55 0,44 1,26 27,8 8,99 16,00
30 070504-04 8,291 4,948 1,68 414,5 0,60 24,39
31 070517-07 3,196 2,101 1,52 159,8 1,56 23,43
32 070517-08 5,330 3,529 1,51 266,5 0,93 24,06
33 070525-03 2,39 1,58 1,52 120,0 2,08 22,91
25
34 070601-01 2,63 1,49 1,76 131,8 1,89 23,10
35 070608-02 14,227 8,066 1,76 711,3 0,35 24,64
36 070628-02 0,17 0,11 1,49 8,7 25,00 0
37 070517-10 0,190 0,121 1,57 9,5 25,00 0
38 070504-05 0,99 0,579 1,71 49,5 5,05 19,94
39 070608-01 0,356 0,228 1,57 17,8 14,04 10,95
40 070601-05 0,53 0,35 1,48 26,6 9,39 15,60
41 070601-07 0,40 0,26 1,53 20,4 12,25 12,74
42 070525-02 0,87 0,56 1,55 43,5 5,74 19,25
43 070608-04 3,211 2,011 1,60 160,5 1,55 23,44
44 070621-04 0,503 0,39 1,30 25,1 9,96 15,03
45 070628-01 0,31 0,19 1,64 15,9 15,72 9,27
46 070628-03 0,48 0,305 1,57 24,0 10,41 14,58
47 070628-05 0,31 0,197 1,61 15,8 15,82 9,17
48 070628-06 0,451 0,345 1,31 22,5 11,11 13,88
49 070621-01 0,43 0,33 1,32 21,7 11,52 13,47
50 070621-02 2,8 2,1 1,32 140,5 1,77 23,22
51 070621-05 1,13 0,63 1,80 56,9 4,39 20,60
52 070608-03 0,874 0,292 1,35 14,6 17,12 7,87
53 070601-03 1,0 0,72 1,40 50,5 4,95 20,04
54 070601-02 1,99 1,29 1,55 99,8 2,50 22,49
55 070601-06 8,27 4,92 1,63 413,7 0,60 24,39
6.4. Definición del estado retroviral de los gatos.
6.4.1 Ensayo de PCR para VIF.
Se consideraron positivos a VIF todos los gatos cuyas muestras generaron
secuencias que resultaron altamente similares (>90% de alineamiento en BLAST) a las
secuencias registradas en el banco de genes. El estado de VIF detectado en cada una de las
muestras es presentado en la tabla Nº 5. En la población general de gatos, el 56,4% (31/55)
resultaron positivos a VIF. Esta alta prevalencia es altamente afectada por la composición
de la subpoblación 1 (n=29), en la que los gatos provenían desde el hospital veterinario o
del banco de sangre, siendo seleccionados por tener un estado positivo a VIF determinado
mediante prueba serológica. En ellos se encontró una prevalencia de 96,5% (28/29)
positivos a VIF mediante PCR. En la subpoblación 2 de gatos provenientes de la sociedad
protectora de los animales (n=26), sin información previa al respecto, tres gatos se
encontraron positivos a VIF mediante PCR, lo que significa una prevalencia de 11,5%. La
26
diferencia en la prevalencia de VIF entre ambos grupos, es altamente significativa
(P<0,001).
6.4.2. Prueba serológica de ViLeF.
La prueba serológica se realizó en 54 de las muestras sanguíneas, obteniendo un resultado
de 46,3% (25/54) de positividad en la población general de los gatos (tabla Nº 5). Al
analizar la prevalencia de ViLeF en las subpoblaciones de origen se encontró 35,7% en la
subpoblación 1 versus 58% en la subpoblación 2. Esta diferencia no es estadísticamente
significativa (P=0,172).
Tabla Nº 5. Resumen del estado retroviral (VIF y ViLeF).

de serie
Nº Muestra
Estado
VIF
Estado
ViLeF
1 1018 + -
2 4230 + -
3 1456 + -
4 1692 + -
5 1832 + -
6 3916 + -
7 4180 + -
8 5066 + -
9 5141 + +
10 7174 - +
11 0068 + +
12 7618 + +
13 219 + -
14 234 + -
15 80293793 + +
16 60049A + -
17 9774 + -
18 1019 + +
19 3991 + -
20 1028 + +
21 9949 + -
22 1104 + -
23 3625 + -
24 4050 + +
25 61939 + +
26 9530 + +
27 60041 + -
28 43866 + N/I
29 0063 + -
30 070504-04 - +
31 070517-07 - +
32 070517-08 - +
33 070525-03 - -
34 070601-01 - -
35 070608-02 - -
36 070628-02 + +
37 070517-10 - +
38 070504-05 - +
39 070608-01 - +
40 070601-05 - -
41 070601-07 + -
42 070525-02 - -
43 070608-04 - -
44 070621-04 - +
45 070628-01 - -
46 070628-03 - +
47 070628-05 - +
48 070628-06 + +
49 070621-01 - +
50 070621-02 - -
51 070621-05 - +
52 070608-03 - -
53 070601-03 - +
54 070601-02 - +
55 070601-06 - -
27
6.5. Ensayo de PCR para Mycoplasma hemotrópico.
6.5.1. PCR de las muestras de control positivo.
El PCR realizado con las muestras de control positivo obtenidas desde la
Universidad de Bristol, dio como resultado productos de tamaño de 190 pares de bases (bp)
para CM haemominutum y de 170 bp para CM turicensis y M haemofelis, como se observa
en la fotografía digital obtenida de la electroforesis presentada en la figura Nº 1. Los
productos fueron purificados, secuenciados y analizados en BLAST entregando un
resultado de 100, 100 y 96% de similitud a las secuencias de M haemofelis, CM
haemominutum y CM turicensis respectivamente, registradas en el banco genético (Anexo
Nº 1).
6.5.2. PCR para Mycoplasma hemotrópico en la población general de gatos.
Se realizaron ensayos de PCR con el ADN obtenido desde las muestras de sangre y
los productos fueron identificados por electroforesis. Todos los productos que se
encontraron positivos fueron purificados desde el gel y luego secuenciados. El 49% de los
gatos (27/55) se encontraron positivos a Mycoplasma hemotrópico.
Coinfección.
En algunas muestras, el desarrollo de la electroforesis evidenció la presencia de
productos de distintos tamaños moleculares, marcando bandas de distintas alturas como se
muestra en la figura Nº 2. Las bandas fueron cortadas y secuenciadas separadamente. En
dos de los casos (7,4% de los gatos positivos) se logró comprobar la presencia simultánea
de dos especies de Mycoplasma hemotrópico. En uno de los casos se encontró CM
haemominutum junto con M haemofelis y en el otro, se encontró CM haemominutum junto
con CM turicensis.
28
Figura Nº 1. Fotografía digital del gel de agar mostrando las bandas fluorescentes de los
productos de PCR de los controles positivos y negativos.
Figura Nº 2. Fotografía digital del gel de agar mostrando las bandas fluorescentes de los
productos de PCR de muestras de ADN.
1. Escala de peso molecular, 2. M haemofelis, 3. CM
haemominutum, 4. CM turicensis, 5. Control negativo.
1 2 3 4 5
190 bp
170 bp
1. Escala de peso molecular, 2. Coinfección en una muestra positiva; CM
Haemominutum y M haemofelis, 3. Muestra negativa, 4. Control negativo,
5. Control positivo de M haemofelis.
1 2 3 4 5
190 bp
170 bp
29
Muestras negativas.
Las 28 muestras presentadas en la tabla Nº 6, no generaron ninguna banda en el
ensayo de electroforesis, por lo tanto se reconocieron como negativas a Mycoplasma
hemotrópico y no fueron sometidos a los siguientes pasos del proceso. Cuando los resultado
fueron dudosos (banda muy clara o banda en una altura inadecuada) el ensayo de PCR se
repitió.
Tabla Nº 6. Muestras de resultado negativo.
Nº de
serie
Nº de
muestra
1 3991
2 1028
3 9949
4 1104
5 3625
6 4050
7 61939
8 9530
9 60041
10 43866
11 0063
12 9774
13 1692
14 070525-02
15 070608-04
16 070621-04
17 070628-01
18 070628-03
19 070628-05
20 070628-06
21 070621-01
22 070621-02
23 070621-05
24 070608-03
25 070601-03
26 070601-02
27 070601-06
28 070608-02
6.6. Prevalencia de Mycoplasma hemotrópico.
Al analizar los resultados de PCR para Mycoplasma hemotrópico (tabla Nº 7), se
encontró una prevalencia de 49% en la población general de gatos (27/55) y en las distintas
subpoblaciones y subgrupos se encontraron las siguientes prevalencias: en la subpoblación
1 se observó un 55,2% (16/29) versus 42,3% (11/26) en la subpoblación 2, con una
significancia estadística de P=0,341 (gráfico Nº 2), en los gatos adultos 50% (9/18) versus
38,1% (8/31) en los jóvenes (P=0,455) (gráfico Nº 4) y en los machos 55.2% (16/29) versus
42,1% (8/19) en las hembras (P=0,376) (gráfico Nº 5).
Al comparar la prevalencia de Mycoplasma hemotrópico en los subgrupos
segmentados por el estado retroviral (tabla Nº 7), se encontraron los siguientes resultados:
30
en los gatos de estado de VIF positivo 54,8% (17/31) versus en los VIF negativos 41,7%
(10/24) (P=0,333). En los gatos positivos a ViLeF 52% (13/25) versus en los negativos
48,3% (14/29) (P=0,785). En los gatos positivos a retrovirus (que son positivos al menos a
un agente retroviral) 53,3% (24/45) versus en los retrovirus negativos 30% (3/10)
(P=0,182) (gráfico Nº 3). 11 gatos resultaron positivos a ambos agentes retrovirales, 6 de
los cuales fueron positivos a Mycoplasma hemotrópico (54,5%), en comparación a la
prevalencia de 30% encontrada en los gatos negativos a retrovirus (P=0,256).
A pesar de existir una tendencia de mayor prevalencia en algunos de los grupos y
un mayor riesgo relativo de contagio con Mycoplasma hemotrópico en algunos de los
grupos comparados, las diferencias no fueron significativas a la prueba de Chi cuadrado,
entendiéndose que son independientes al criterio de la segmentación. Sin embargo, se cree
que las diferencias podrían llegar a tener una importancia estadística si se analizaran un
número mayor de gatos.
Tabla Nº 7. Prevalencia de Mycoplasma hemotrópico en las subpoblaciones y
subgrupos de gatos.
Categoría
Indicador
VIF
+
VIF
-
ViLeF
+
ViLeF
-
RV
+
RV
-
VIF +
ViLeF
+
RV
-
Prevalencia
(N/total)
17/31 10/24 13/25 14/29 24/45 3/10 6/11 3/10
Prevalencia (%) 54,8 41,7 52 48,3 53,3 30 54,5 30
Valor de P 0,333 0,785 0,182 0,256
Riesgo relativo 1,316 1,077 1,778 1,818
CI 95% 0,34-2,33 0,63-1,83 0,66-4,76 0,61-5,41


Gráfico Nº 2. Gráfico Nº 3.
Gráfico Nº 4. Gráfico Nº 5.
Gráfico Nº 4. Gráfico Nº 5.
Gráfico Nº 4. Gráfico Nº 5.
38,10%
50%
0,00%
20,00%
40,00%
60,00%
80,00%
100,00%
< 1 año > 1 año
Prevalencia
Prevalencia de Mycoplasma hemotrópico
en los subgrupo de edad
55,20%
42,10%
0,00%
20,00%
40,00%
60,00%
80,00%
100,00%
Masculino Femenino
Prevalencia
Prevalencia de Mycoplasma hemotrópico
en los subgrupo de género
53,30%
30%
0,00%
20,00%
40,00%
60,00%
80,00%
100,00%
RV + RV -
Prevalencia
Prevalencia de Mycoplasma hemotrópico en
los subpoblaciones de estado retroviral
55,20%
42,30%
0,00%
20,00%
40,00%
60,00%
80,00%
100,00%
SP No. 1 SP No. 2
Prevalencia
Prevalencia de Mycoplasma hemotrópico
en los subpoblaciones de origen
32
6.7. Secuenciación, alineamiento y prevalencia de las especies de Mycoplasma
hemotrópico.
6.7.1. Secuenciación y alineamiento de los productos de PCR.
Los productos de PCR que resultaron positivos a la electroforesis, fueron
secuenciados y analizados en el programa BLAST. Cada muestra analizada generó una lista
con los aislados más similares registrados en el banco genético, con el porcentaje de
similitud entre ellos y un diagrama de alineamiento para cada aislado (anexo Nº 1). En la
tabla Nº 8, se resumen los resultados de los análisis realizados para todas las muestras
positivas. Luego de las columnas de identificación (Nº de serie, Nº de muestra y Nº de
secuenciación), se menciona el Nº de acceso (en el banco genético) del aislado, al cual se
encontró más cercana la secuencia obtenida y la especie de Mycoplasma hemotrópico a
que pertenece. Además, de la longitud del segmento que se encontró similar y del
porcentaje de alineamiento encontrado entre ambos.
Tabla Nº 8. Resumen de los resultados del análisis del alineamiento.

Serie

Muestra

Secuenciación
Nº De acceso del
aislado mas
cercano
Especie encontrada
de hemoplasma
Longitud
del
segmento
Alineamiento
(%)
1
Control
positivo OWCMH AB294159.1 CM haemominutum 156
100
2 4230 OW005 AB294160.1 CM haemominutum 142 100
3 1456 OW007 AB294159.1| CM haemominutum 126 100
4 1832 OW014 AB294159.1 CM haemominutum 119 96
5 219A OW018A AB294159.1 CM haemominutum 171 100
6 5066 OW020 AB294159.1 CM haemominutum 171 100
7 234 OW022 AB294159.1 CM haemominutum 167 100
8 7618 OW023 AB294159.1 CM haemominutum 171 100
9 3916 OW024 AB294160.1 CM haemominutum 170 99
10 7174 OW026 DQ825457.1 CM haemominutum 125 89
11 5141 OW027A AB294160.1 CM haemominutum 169 100
12 60049 OW028A AB294159.1 CM haemominutum 159 100
13 0068 OW029 AB294159.1 CM haemominutum 171 100
14 070601-01 OW032 AB294159.1 CM haemominutum 169 100
15 070504-04A OW034A AB294160.1 CM haemominutum 160 86
16 070608-01 OW040 AB294159.1 CM haemominutum 154 88
17 1019 OW046 AB294160.1 CM haemominutum 103 100
18
Control
positivo OWCMT DQ825450.1 CM turicensis 136
93
19 1018 OW16A DQ464425.1 CM turicensis 145 98
20 070628-02 OW009 DQ825450.1 CM turicensis 121 97
21 070517-10 OW013 DQ825450.1 CM turicensis 116 98
33
22 070517-08 OW033 DQ825450.1 CM turicensis 144 98
23 070504-04B OW034B DQ825450.1 CM turicensis 144 98
24 070517-07 OW035 DQ825450.1 CM turicensis 144 98
25 070525-03 OW036 DQ825450.1 CM turicensis 145 99
26 070601-07 OW041 DQ825450.1 CM turicensis 139 95
27 070601-05 OW039 DQ825450.1 CM turicensis 136 94
28 070504-05 OW038 DQ825450.1 CM turicensis 144 98
29
Control
positivo OWMHF EU145745.1 M haemofelis 149
100
30 4180 OW025 EU145745.1 M haemofelis 149 100
31 3793 OW021 EU145745.1 M haemofelis 147 99
32 219B OW018B EU145745.1 M haemofelis 145 100
6.7.2. Prevalencia de las especies de Mycoplasma hemotrópico.
Al conocer la identidad de la especie de Mycoplasma hemotrópico encontrado en
cada muestra, se procedió a analizar la prevalencia de cada una de las especies en los
distintos grupos y su importancia estadística, mediante la prueba de Chi cuadrado.
En la población general de los 55 gatos, se encontraron 28 gatos negativos y 27
gatos positivos a Mycoplasma hemotrópico. Entre los gatos positivos 3 (5,45%), 16 (29%)
y 10 (18,2%) fueron reconocidos como portadores de M haemofelis, CM haemominutum y
CM turicensis respectivamente (cada caso de coinfección se consideró como dos hallazgos
independientes de Mycoplasma hemotrópico), revelando una diferencia significativa entre
la baja prevalencia de M haemominutum y las de CM haemominutum (P=0,001) y CM
turicensis (P=0,039), como se presenta en la tabla Nº 9 y en el gráfico Nº 6.
Tabla Nº 9. Prevalencia de las especies de Mycoplasma hemotrópico en la población
general de gatos.
Agente
Población
General
Mycoplasma
hemotrópico
M
haemofelis
CM
haemominutum
CM
turicensis
Prevalencia
N/total (%) N/total (%) N/total (%) N/total (%)
27/55 49 3/55 5,45*,** 16/55 29,09* 10/55 18,2**
Valor de P
0,001* 0,039**
Riesgo relativo 0,188 0,3
CI 95% 0,06-0,61 0,09-1,03
Gráfico Nº 6.
Al analizar las prevalencias (tabla Nº 10), la proporción de las distintas especies de
Mycoplasmas hemotrópicos fue significativamente diferente entre las subpoblaciones 1 y
2, encontrando una prevalencia mayor de
(P=0,007) y de CM turicensis
pertenencia de un gato a la subpoblación 1 implica un riesgo de portar
en 3,9 veces mayor en relación a la subpoblación 2. Mientras que, el riesgo relativo de
portar CM turicensis es 10 veces menor en la subpoblación 1 en relación a la subpoblación
2 (RR=0,1). La prevalencia de
subpoblaciones de origen (P=0,092) (tabla Nº 10 y gráfico Nº 7).
Tabla Nº 10. Prevalencia de las especies de
subpoblaciones de origen.
Agente
Subpoblación
Mycoplasma
hemotrópico
N/total (%)
SP 1 16/29 55,2
SP 2 11/26 42,3
Valor de P 0,341
Riesgo relativo
CI 95%
MHF
5,45%
CMH
29,09%
CMT
18,2%
Prevalencia de las tres especies de
Mycoplasma hemotrópico en la población
general de gatos.
34
CM haemominutum en la subpoblación 1
en la subpoblación 2 (P=0,003), Comprobando que la
CM haemominutum
M haemofelis no fue significativamente distinta entre las dos
Mycoplasma hemotrópico
M haemofelis CM haemominutum
N/total (%) N/total (%)
3/29 10,3 13/29 44,8*
0/26 0 3/26 11,5*
0,092 0,007*
3,885
1,24-12,13
N= negativo,
MHF= M
CMH= CM haemominutum
CMT= CM turicensis.
N
48%
en las
CM turicensis
N/total (%)
1/29 3,4**
9/26 34,6**
0,003**
0,1
0,01-0,73
haemofelis,
haemominutum,
Gráfico Nº 7.
Similarmente, en los subgrupos de edad y género se encontraron diferencias en la
distribución de las especies (tabla
prevalente entre los gatos adultos y los machos
respectivamente), mientras que en los gatos jóvenes y en las hembras lo fue
(P=0,651 y P=0,138 respectivament
los subgrupos comparados, se encontró estadísticamente significativa solamente en el caso
de la mayor prevalencia de
que existe una relación entre el género masculino y la presencia de
Los gatos machos presentaron un riesgo relativo mayor por 3,931 que en las hembras de
presentar esta especie de Mycoplasma
podría deducir que las diferencias encontradas no se deben al criterio de la segmentación y
podrían deberse a diferentes factores como el origen y el estado retroviral de los gatos,
entre otros.
-10,00%
0,00%
10,00%
20,00%
30,00%
40,00%
50,00%
60,00%
MHF
Prevalencia
Prevalencia de las especies de Mycoplasma
hemotrópico en las subpoblaciones de
origen.
SP 1
SP 2
35
ión Nº 1 y gráficos Nº 8 y 9), siendo la especie más
CM haemominutum (P=0,298 y P=0,021
respectivamente). La diferencia de la distribución de las especies entre
CM haemominutum en los gatos machos (P=0,021), sugiriendo
n CM haemominutum.
hemotrópico. En el resto de las comparaciones, se
as CMH CMT
CM turicensis
e).
Tabla Nº 11. Prevalencia de las especies de
de edad y de género.
Agente
Sub-
Grupo
Mycoplasma
hemotrópico
N/total (%)
< 1 año 8/21 38,1
> 1 año 9/18
Valor de P 0,455
Riesgo relativo 1,313
CI 95% 0,64-2,68
Hembras 8/19 42,1
Machos 16/29 55,2
Valor de P 0,376
Riesgo relativo 1,31
CI 95% 0,7-2,44
Gráfico Nº 8. Gráfico Nº 9.
0%
5%
10%
15%
20%
25%
30%
MHF CMH
Prevalencia
Prevalencia de las especies de
Mycoplasma hemotrópico en las
subpoblaciones de edad
< 1 año
> 1 año
36
Mycoplasma hemotrópico en los su
M haemofelis CM haemominutum
N/total (%) N/total (%)
0/21 0 3/21 14,3
50 1/18 5,6 5/18 27,8
0,274
0,298
1,944
0,54-7,03
0/19 0 2/19 10,5*
2/29 6,9 12/29 41,4*
0,242 0,021*
- 3,931
- 0,99-15,64
0%
5%
10%
15%
20%
25%
30%
35%
40%
45%
MHF CMH
Prevalencia
Prevalencia de las especies de
Mycoplasma hemotrópico en las
subpoblaciones de género
Masculino
Femenino
CMT
subgrupos
CM turicensis
N/total (%)
6/21 28,6
4/18 22,2
0,651
0,778
0,26-2,33
6/19 31,6
4/29 13,8
0,138
0,437
0,14-1.35
CMT
37
Analizando los subgrupos segmentados de acuerdo al estado retroviral de los gatos,
se encontraron los siguientes resultados (tabla Nº 12):
En los gatos con estado retroviral positivo (que portan al menos un agente
retroviral), se encontró una distribución de especies estadísticamente similar a la encontrada
en los gatos negativos (M haemofelis P=0,401; CM haemominutum P=0,142; CM turicensis
P=0,869) (gráfico Nº 10).
En el caso de la segmentación en subpoblaciones de acuerdo al estado de ViLeF,
tampoco se encontró una diferencia significativa en la distribución de las especies (M
haemofelis P=0,643; CM haemominutum P=0,808; CM turicensis P=0,336) (gráfico Nº 11).
Los resultados de mayor interés fueron los encontrados en el caso de la
segmentación por el estado de VIF, en el cual las diferencias de distribución de las especies
fueron más marcadas. En la subpoblación VIF positivo, se encontró una prevalencia de
38,7% de CM haemominutum en comparación al 16,7% en la subpoblación VIF negativo.
Así, se encontró un riesgo mayor de 2,3 veces de encontrar esta especie de Mycoplasma
hemotrópico en el gato portador de VIF que en uno libre de este agente viral (RR=2,323).
En cambio, la prevalencia de CM turicensis en la subpoblación VIF negativo fue de un
29,2%, mayor a la prevalencia de 9,7% encontrada en la subpoblación VIF positivo
(gráfico Nº 12), sugiriendo que los gatos libres de VIF tienen riesgo de 3,014 veces mayor a
portar CM turicensis que los portadores de VIF.
Al realizar la prueba de Chi-cuadrado, los valores de P encontrados en ambos casos
fueron levemente superiores al valor crítico de 0,05 (P=0,074 en CM haemominutum y
P=0,063 en CM turicensis) y es posible asumir que se debe al bajo tamaño de las
subpoblaciones.
38
Tabla Nº 12. Prevalencia de las especies de Mycoplasma hemotrópico en
las subpoblaciones de acuerdo al estado retroviral.
Agente
Subpoblación
Mycoplasma
hemotrópico
M
haemofelis
CM
haemominutum
CM turicensis
N/total (%) N/total (%) N/total (%) N/total (%)
RV+ 24/45 53,3 3/45 6,7 15/45 33,3 8/45 17,8
RV- 3/10 30,0 0/10 0 1/10 10,0 2/10 20,0
Valor de P 0,182 0,401 0,142 0,869
Riesgo relativo 1,778 - 3,333 0,889
CI 95% 0,66-4,76 - 0,5-22,39 0,22-3,57
ViLeF+ 13/25 52,0 1/25 4,0 7/25 28,0 6/25 24,0
ViLeF- 14/29 48,3 2/29 6,9 9/29 31,0 4/29 13,8
Valor de P 0,785 0,643 0,808 0,336
Riesgo relativo 1,077 0,58 0,902 1,74
CI 95% 0,63-1,83 0,06-6,02 0,39-2,07 0,55-5,48
VIF + 17/31 54,8 3/31 9,7 12/31 38,7 3/31 9,7
VIF - 10/24 41,7 0/24 0 4/24 16,7 7/24 29,2
Valor de P 0,333 0,117 0,074 0,063
Riesgo relativo 1,316 - 2,323 0,332
CI 95% 0,34-2,33 - 0,86-6,3 0,1-1,15
VIF+ ViLeF+ 6/11 54,5 1/11 9,1 4/11 36,4 1/11 9,1
RV - 3/10 30 0/10 0 1/10 10 2/10 20
Valor de P 0,256 - 0,157 0,476
Riesgo relativo 0,256 - 3,636 0,455
CI 95% 0,61-5,41 - 0,48-27,33 0,05-4,28
Gráfico Nº 10.
Gráfico Nº 12.
0,00%
10,00%
20,00%
30,00%
40,00%
50,00%
60,00%
70,00%
80,00%
N MHF CMH
Prevalencia
Prevalencia de las especies de
Mycoplasma hemotrópico en las
subpoblaciones de estado retroviral
RV+
RV-
0,00%
10,00%
20,00%
30,00%
40,00%
50,00%
60,00%
N MHF CMH
Prevalencia
Prevalencia de las especies de
hemotrópico en las subpoblaciones de
estado VIF
VIF+
VIF-
39
Gráfico Nº 11.
Gráfico Nº 13.
CMT
CMT
Mycoplasma
0,00%
10,00%
20,00%
30,00%
40,00%
50,00%
60,00%
N MHF
Prevalencia
Prevalencia de las especies de
Mycoplasma hemotrópico en las
subpoblaciones de estado ViLeF
ViLeF+
ViLeF-
0,00%
10,00%
20,00%
30,00%
40,00%
50,00%
60,00%
N MHF
Prevalencia
Prevalencia de las especies de
hemotrópico en las subpoblaciones de estado
ViLeF y VIF
ViLeF+/VIF+
RV-
CMH CMT
CMH CMT
Mycoplasma
40
7. DISCUSIÓN
1. La prevalencia de Mycoplasma hemotrópico encontrada en la sangre de gatos en
Israel fue de un 49%. Esta prevalencia, es marcadamente superior (P<0,001) a las descritas
en investigaciones realizadas en otros países, como por ejemplo la encontrada por Jensen et
al. en EEUU en 2001 de un 19,5%. La alta prevalencia se puede atribuir a un conjunto de
factores y condiciones, entre los cuales los siguientes parecen tener una mayor importancia:
el clima mediterráneo caluroso que existe en Israel, en el cual la presencia de artrópodos
hematófagos, y por lo tanto, la transmisión indirecta (y principal) de los Mycoplasmas
hemotrópicos se ven favorecidas, como fue demostrado en Suiza, en un ensayo que
comparó la prevalencia de gatos portadores de Mycoplasma hemotrópico en distintas
regiones de ese país, encontrando una mayor prevalencia en los gatos provenientes de las
regiones más cálidas (Willi et al., 2006b). Otra causa importante parece ser el gran número
de gatos callejeros que fueron incluidos en este estudio (26/55). Anteriormente, se ha
demostrado que gatos que tienen acceso a la calle (un hábito de vida "out door"), se
encuentran en un riesgo mayor a contraer el agente que uno que no sale a la calle ni
interactúa con otros gatos ("in door") (Willi et al., 2006a y 2007). Con mayor razón, un
gato callejero que tiene contacto continuo con otros, tiene una intensa exposición al agente
ya sea por compartir alimentos, fuentes de agua, intercambiar parásitos y pelear por su
territorio. Además, no existió ninguna información sobre el estado sanitario de estos gatos,
por lo que se puede asumir que no fueron sometidos a tratamiento preventivo alguno,
aumentando la probabilidad de una masiva infestación de parásitos hematófagos. Otro
factor que parece tener gran importancia es la alta prevalencia de gatos portadores de
agentes retrovirales (VIF y ViLeF) (81,8%) revelada en el ensayo. Se sabe que el VIF
suprime el sistema inmune y así, aumenta la probabilidad del animal de ser portador de
varios agentes infecciosos, entre ellos Mycoplasma hemotrópico y/o presentar
enfermedades clínicas en los gatos (Messick, 2004).
41
Un estudio reciente realizado en Brasil, que al igual que Israel representa una región
geográfica calurosa, incorporó gatos portadores de VIF y de ViLeF, revelando una
prevalencia de Mycoplasma hemotrópico de 50% en gatos portadores de ambos virus y 36%
en portadores de VIF, un resultado similar a la prevalencia de 54,5 y 54,8% (P=1,00 y
P=0,187) encontrada en los grupos respectivos en los gatos en Israel (Macieira et al., 2007),
siendo esta una prevalencia superior a las previamente mencionadas en Europa o en los
Estados Unidos.
Una razón técnica que podría explicar la alta prevalencia, es el uso de partidores
universales para Mycoplasma que por su naturaleza detectan cualquier variedad de
Mycoplasma que se encuentre en la muestra. Sin embargo, en el estudio desde los cuales se
obtuvieron las secuencias de los partidores universales de Mycoplasma (Jensen et al.,
2001), se encontró una prevalencia de 19,5% solamente. La diferencia entre las
prevalencias en los dos estudios, se podría explicar por el gran aumento de variedades de
las especies conocidas y la agregación de CM turicensis a la base de datos del banco
genético, en que se realizó el análisis de las secuencias obtenidas, desde el año 2001 y hasta
el actual. En el caso de CM turicensis, al comparar la prevalencia encontrada en el ensayo
con las reveladas por Willi et al., en 2006, en diferentes países, se encontró que la de Israel
(18,2%) es muy superior (P<0,001) a las encontradas en Suiza (1,0%) y en el Reino Unido
(2,3%) pero es estadísticamente similar a las encontradas en Australia (10%) (P=0,150) y
en Sudáfrica (26%) (P=0,388).
2. A pesar de que la prevalencia de Mycoplasma hemotrópico encontrada en la
población general de los gatos fue alta, el análisis de la prevalencia de las especies de
Mycoplasma hemotrópico, demostró que M haemofelis es la especie de menor prevalencia,
en comparación a CM haemominutum (P=0,001) y CM turicensis (P=0,039), un hecho que
podría tener una importancia en el área de la clínica, ya que se conoce que M haemofelis es
la especie relacionada con la infección aguda en los felinos (Harrus et al., 2002).
Al analizar la prevalencia de Mycoplasma hemotrópico en las subpoblaciones de
origen y de estado retroviral, no se encontraron diferencias significativas. Sin embargo, al
analizar la prevalencia de las distintas especies de Mycoplasma hemotrópico en las
subpoblaciones, se encontró una diferencia significativa entre las subpoblaciones 1 y 2, y
42
una diferencia muy cercana al límite aceptable entre los gatos de estado VIF positivo y
negativo. Para la subpoblación 1 y los gatos VIF positivo, CM haemominutum presentó
mayores prevalencias que las encontradas en las subpoblaciones 2 (P=0,007) y FIV
negativo (P=0,074), mientras que CM turicensis fue la especie más prevalente en la
subpoblación 2 (P=0,003) y en los gatos VIF negativo (P=0,063). Se sabe que tanto CM
haemominutum como CM turicensis, son especies que poseen efectos patógenos,
principalmente en el caso de coinfección con M haemofelis o con otra enfermedad
debilitante (Messick 2004; Willi et al., 2005).
Es importante mencionar que el 86% de los gatos positivos a CM turicensis (6/7)
fueron gatos callejeros y tuvieron un origen físico común (gatería de Tel Aviv). Se puede
asumir que el contacto físico generado por el hacinamiento, durante el alojamiento en la
gatería aumenta la tasa de transmisión del agente entre los gatos, aunque se cree que sería la
conducta agresiva, más que el uso común de utensilios como comederos y bebederos, la
que tendría mayor importancia en la transmisión del agente (Willi et al., 2006 a, b).
3. Al igual que en las subpoblaciones, se analizó la prevalencia de Mycoplasma
hemotrópico encontrada en los distintos subgrupos. En ambas categorías de edad, se
encontraron prevalencias altas, pero no se encontró una diferencia significativa (P=0,455),
hecho que se podría deber a las características especiales de cada una: la gran mayoría
(88%) de los gatos de un año de vida o más (los más factibles de ser portadores de
Mycoplasma hemotrópico por mayor exposición) (Tasker et al., 2003), fueron gatos
portadores de VIF (16/18) y algunos de ellos con una enfermedad clínica, hecho que
aumenta la probabilidad a encontrar gatos positivos a Mycoplasma hemotrópico. A la vez,
los gatos jóvenes incluidos en este ensayo (considerados como más predispuestos a
contagiarse con el agente al no tener el sistema inmune completamente desarrollado),
fueron gatos callejeros que probablemente estuvieron expuestos al agente continuamente
durante su vida. Además, al ser callejeros, su interacción con otros gatos es más frecuente
que en el caso del gato de casa, facilitando el intercambio de parásitos hematófagos y los
encuentros agresivos que resultan en lesiones.
En el caso de los subgrupos divididos según los distintos géneros, la diferencia de
prevalencia de Mycoplasma hemotrópico tampoco fue significativa (P=0,376). Algunas
43
investigaciones, describen que no existe diferencia entre géneros (Bobade et al., 1986),
pero otros describen mayor prevalencia en los machos, apuntando principalmente a su
conducta agresiva y el hábito “out door” más frecuente por la conducta sexual (Willi et al.,
2006a y 2007).
En este ensayo la proporción entre machos (n=29) y hembras (n=19) no fue
balanceada y existieron 7 gatos de género desconocido, hecho que tal vez modificó los
resultados. Además, tiene importancia el hecho que la mayoría de las hembras (89,5%) que
participaron en este ensayo (17/19) fueron gatas callejeras (“out door”) y por lo tanto con
una exposición alta y continua al agente. En el análisis de la prevalencia de las especies de
Mycoplasma hemotrópico en los subgrupos, se encontró una relación entre el género
masculino y la presencia de CM haemominutum, determinando una diferencia significativa
(P=0,021) entre la prevalencia de esta especie del agente en los machos (41,4%) con
respecto a las hembras (10,5%).
Esto se explica, en base de la relación anteriormente demostrada entre el género
masculino y la alta prevalencia de VIF en comparación con las hembras (P=0,001;
RR=2,222; CI95% 1,29-3,84) y de la alta prevalencia de CM haemominutum en la
subpoblación VIF positivo en comparación a la subpoblación VIF negativo (RR=2,323),
sugiriendo que la alta prevalencia de CM haemominutum en los machos se debe a la alta
prevalencia de VIF y su efecto supresor sobre el sistema inmune.
4. Los casos mencionados con coinfección fueron solamente dos, encontrando un
mayor número de casos de aparición de bandas múltiples en los ensayos de electroforesis.
Los partidores universales para Mycoplasma generaron productos de tamaño muy similar
(170 y 190 bp), lo cual produce una dificultad técnica en la separación de las bandas. En la
gran mayoría de los casos, al menos uno de los productos no generó resultado especifico al
secuenciarlo, por contener una cantidad o calidad insuficiente. Por este motivo, se
sospecha que la importancia porcentual de las coinfecciones resultó subestimada al usar
esta técnica. Para mejorar la exactitud de este parámetro, se debería utilizar un PCR
especifico para cada especie conocida de Mycoplasma hemotrópico, en cada muestra. Por
defecto, especie o variedades desconocidas no se encontrarían.
44
5. En el ensayo de PCR para la detección de VIF en la subpoblación 1 que fue
seleccionada por el estatus positivo a VIF de los gatos, determinado mediante una prueba
serológica, se encontró una prevalencia de 96,5% (28/29). Esta similitud indica que las dos
técnicas entregan resultados similares en la detección de VIF, lo que nos permite comparar
los resultados de este estudio con estudios anteriores en que solamente detectaron VIF
mediante una prueba serológica.
En la subpoblación 2, los gatos fueron seleccionados al azar con respecto al estatus
de VIF o su estado de salud y por lo tanto, esto nos permite inferir el resultado a la
población de gatos callejeros en general. En este caso se encontró una prevalencia de
11,5%. Esta prevalencia es similar (P=1,00) a la encontrada en Israel del 12% mediante una
prueba serológica (Baneth et al., 1999).
Sorprendentemente, la prevalencia de ViLeF encontrada en Israel (2008) mediante
un ensayo serológico (46,3%), fue significativamente superior (P<0,001) a la reportada por
Baneth et al. (1999) del 3,8%, detectada mediante la misma técnica. La diferencia se podría
atribuir a la composición ya mencionada de la población de gatos estudiada.
45
8. CONCLUSIONES.
- Las tres especies de Mycoplasma hemotrópico internacionalmente conocidas; M
haemofelis, CM haemominutum y CM turicensis, fueron encontradas en sangre de gatos de
Israel y pueden ser detectadas con certeza mediante un ensayo especifico de PCR.
- La prevalencia de hemoplasma en gatos de Israel parece ser más alta que la estimada en
otros países debido a distintas razones.
- Aparentemente la prevalencia de las distintas especies de hemoplasma, varía en
poblaciones de gatos de diferentes características. Así, se requiere el análisis de una
muestra de tamaño mayor para demostrar una relación más ajustada.
- Se requieren estudios posteriores de este agente en técnicas complementarias como es el
PCR de tiempo real específico para cada especie de hemoplasma, lo que permitiría estudiar
las características adicionales del agente, su efecto clínico y epidemiología. Un tema
importante para estudios posteriores es la interacción de las especies de hemoplasma en
casos de coinfección de dos o más especies, las condiciones epidemiológicas que la
permiten, su efecto clínico y sus consecuencias.
46
9. BIBLIOGRAFÍA
- BANETH, G.; KASS, P.; STEINFELD, D.; BESSER, M. 1999. A
seroepidemiological of feline coronavirus, feline immunodeficency virus and feline
leukemia virus among cats in Israel. Israel j vet med. 54 (2): 39-43.
- CRIADO-FORNELIO, A.; MARTINEZ-MARCOS, A.; BULING-SARAÑA, A.;
BARBA-CARRETERO, J.C. 2003. Presence of Mycoplasma haemofelis, Mycoplasma
haemominutum and piroplasmids in cats from southern Europe: a molecular study. Vet.
Microbiol. 93: 307-317.
- GAL, A.; LOEB, E.; YISASCHAR-MEKUZAS, Y.; BANETH, G. 2007.
Detection of Ehrlichia canis by PCR in different tissues obtained during necropsy from
dogs surveyed for naturally occurring canine monocytic ehrlichiosis. Veterinary J.
doi:10.1016/j.tvjl.2007.01.013
- HARRUS, S.; KLEMENT, E.; AROCH, I.; STEIN, T.; BARK, H.; LAVY, E.;
MAZAKI-TOVI, M.; BANETH, G. 2002. Retrospective study of 46 cases of feline
haemobartonellosis in Israel and their relationships with FeLV and FIV infections. Vet.
Rec. 151: 82-85.
- JENSEN, W.; LAPPIN, M.; KAMKAR, S.; REAGAN, W. 2001. Use of a
polymerase chain reaction assay to detect and differentiate two strains of
Haemobartonella felis in naturally infected cats. AJVR, 62(4):604-608.
- MACIEIRA, D.; DE MENDEZ, R.; DAMICO, C.; ALMOSNY, N.; MCLANE,
H.; DAGGY, J.; MESSICK, J. 2007. Prevalence and risk factors for hemoplasmas in
domestic cats naturally infected with feline immunodeficiency virus and/or feline leukemia
virus in Rio de Janeiro e Brazil. J. Feline Med. Surg. 10(2):120-129.
- MESSICK, J.B.; BERENT, L.M.; COOPER, S.K. 1998. Development and
evolution of a PCR-based assay for detection of Hemobartonella felis in cats and
differentiation of H. felis from related bacteria by restriction fragment length analysis. J.
Clin. Microbiol. 36(2):462-466.
- MESSICK, J. B. 2004. Hemotrophic Mycoplasmas (hemoplasmas): a
review and new insights into pathogenic potential. Vet. Clin. Pathol. 33(1):2-13.
- NASH, A.; BOBADE, P. 1986. Haemobartonella felis infection in cats from the
Glasgow area. Vet. Rec. 119: 373-375.
47
- RIKIHISA, Y.; KAWAHARA, M.; WEN, B.; KOCIBA, G.; FUERST, P.;
KAWAMORI, F.; SUTO, C.; SHIBATA, S.; FUTOHASHI, M. 1997. Western
Immunoblot analysis of Haemobartonella muris and comparison of 16S rRNA gene
sequences of H. muris, H. felis, and Eperythrozoon suis. J. Clin. Microbiol. 35(4): 823-
829.
- TASKER, S.; HELPS, C.R.; DAY, M.J.; HARBOUR, D.A.; SHAW, S.E.;
HARRUS, S.; BANETH, G.; LOBETTI, R.G.; MALIK, R.; BEAUFILS, J.P.;
BELFORD, C.R.; GRUFFYDD-JONES, T. J. 2003a. Phylogenetic analysis of
Hemoplasma species: an international study. J. Clin. Microbiol. 41(8): 3877-3880.
- TASKER, S.; BINNS, S.H.; DAY, M.J.; GRUFFYDD-JONES, T.J.; HARBOUR,
D.A.; HELPS, C.R.; JENSEN, W.A.; OLVER, C.S.; LAPPIN, M.R. 2003b. Use of a
PCR assay to assess the prevalence and risk factors for Mycoplasma haemofelis and
'Candidatus Mycoplasma haemominutum' in cats in the United Kingdom. Vet. Rec. 152:
193-198.
- WILLI, B.; BORETTI, F. S.; CATTORI, V.; TASKER, S.; MELI, M.L.;
REUSCH, C.; LUTZ, H.; HOFMANN-LEHMANN1, R. 2005. Identification,
molecular characterization, and experimental transmission of a new hemoplasma isolate
from a cat with hemolytic anemia in Switzerland. J. Clin. Microbiol. 43(6): 2581-2585.
- WILLI, B.; BORETTI, F. S.; BAUMGARTNER, C.; TASKER, S.; WENGER,
B.; CATTORI, V.; MELI, M.L.; REUSCH, C.E.; LUTZ, H.; HOFMANNLEHMANN1,
R. 2006a. Prevalence, risk factor analysis, and follow-up of infections
caused by three feline hemoplasma species in cats in Switzerland. J. Clin. Microbiol.
44(3): 961-969.
- WILLI, B.; TASKER, S.; BORETTI, F.S.; DOHERR, M.G; CATTORI, V.;
MELI, M.L.; LOBETTI, R.G.; MALIK, R.; REUSCH, C.E.; LUTZ, H.; HOFMANNLEHMANN,
R. 2006b. Phylogenetic analysis of “Candidatus Mycoplasma turicensis”
isolates from pet cats in the United Kingdom, Australia, and South Africa, with analysis of
risk factors for infection. J. Clin. Microbiol. 44(12): 4430-4435.
- WILLI, B.; BORETTI F.; TASKER S.; MELI, M.; WENGI, N.; REUSCH, C.;
LUTZ, H.; HOFMANN-LEHMANN, R. 2007. From Haemobartonella to
hemoplasma: molecular methods provide new insights. Vet. Microbiol. Dec. 15;125(3-
4):197-209.

No hay comentarios:

Publicar un comentario en la entrada